GenePrediction:GLEAN_4743 Details

Name: GLEAN_4743
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:663515..661070 (- strand)
Length: 2446
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:663515..662913 (- strand)
Length: 603
Type: CDS
Source: GLEAN
Position: GCSC_167:662838..662507 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_167:662357..661985 (- strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_167:661930..661664 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_167:661411..661070 (- strand)
Length: 342
>GLEAN_4743 class=GenePrediction position=GCSC_167:663515..661070 (- strand)
ATGGCAGAGAACGCTACAGAATCCCATGATGCGGCCCCGGCTGTTCTTTCGGCCGTGCTCGCGGACATTGGCACTTCCTC
CGGCATGAGCACACCTGGCGGTCCGACTACGGGTACCGTGACCCCTGCTCTCTCCGAACTGCCCCCCGACCAGGCCGAGT
ACAGCCTTAGGGTGTCTCTGGCCGACTTGTGCGCCAAGGCGGCCGTTCTGTACTCGCAGCAGAAGAAGTACGAAGAGGCC
GCCGAGGTCTACGCGCGCGCCGCCGAGATCCAGGCCGAGATGAACGGCGAGATGGACCCAGAAAACGCAGAGATTCTCTT
CCTCTACGGCCGCACCCTCTTCAAGGTCGGCCAGGGAAAGAGCGACGTACTGGGCGGCAAGGCACCCGAGGGAAACGCTG
CTTCCAGGGTCGACGGCGGCGAGAAGACCGCTGGCAAGGCTGGAGCCGGACCTGGCCTGATTGCCTCTGCTATTGCAGCC
GGTAGCAGCAGCGAGGCCGGGGGCAGCGCAAGCACGTCCAAGACGGAGGGAGCAGCTCTCGATGCGAAGAAGCCGCTGTT
CCAGTTTGCCGGCGACGAGGAATGGGAAATTTCGGACGAAGAGGTGCGTTCTCGACTCTACAAGTTATTGTCAGCTCTTG
GCGACACGGCTTGGCTAACGTGACAATCTACATATAGGACGCGGCCGACGTAGAGGATGAAGAGAACGTCGAAGAAGAGG
AGGACGATCTCGCCGTGGCTTTTGAGATCCTCGATCTCTCCCGCGTGCTTTTCGAGAAGCAGCTCGCACAGAAGGAAAAG
GAACCGACCGAGTCTGCCGGCGCTGACGATACCACGGCAGCGGAAACTGCCCGGGGGAAGGCTGTCACAAAAGACAATGC
AGAGAAACACGAGCCAGAGGATGAGGCGGGTGCAGAGACCAAAAAACTTTGTCCTTCAACTCGCCACATCATGGAGCGCC
TGGCTGACACCCACGATCTTTTGGCTGAGATCTCTCTGGAGAACGAAAGGTAGGCCCAGGCGGAAGAGCTTCTGCACCAG
ATGTCTCTTTGTCCTTGGGATCCTCCCCCCGCTTCAGCTGAACCGGAAGGACTATCTCGTGACGCAAGGGGCGGCAGCCA
GAGCAGCCCGGCGAGAACAGAGATTAATCCGGTCACAGATACCCAAATGCTATTGTGGATTCCCGAGCCTCTCTGGCCTA
CAAGCAGAAGACCCTCCCGGAAGAATCTGAGATCATTGCCGAAGCACACTTTAAGCTTTCACTCGCACTAGAGTTTGCCT
CTGTCACCACGTCCACGGAAGCAGACGGCGCGGAGGAGGCTGCTGGATCTGCCGACAAGAAGGGGCAGCAGGTCGACCAG
GAGCTGCGCGACGAGGCCGCGCGGGAGCTGGAAGCGGCTATTGTCAGCACCAAGCTCAAGCTGCAGAACAAGGAGGTTGA
GCTGGCCACCGTGCACTCGCCCGAAGACAACGAGTCAACACGCCGGCAGATCACCGAGGTCAAGGAGATTATTGCCGACA
TGGAGCAGCGGGTACGTGTGCAAAACATTCTCTTGTTGTATTTCTTCTACTGACCGGCATCACAGCTTGTCGATCTGCGG
AAGCCGCCCATCGACATCAACGAGGCCGTCAACGGTGCCGCTGGTGCCGCAGTCGGTGGTCTTCTGGGTGCTCTCGGCGG
TGCCGCTGTCGAAGAGGCCAAGAAGGGGGGCAAAGGCCTGACAGGCCTTGTGCGGAAAAAGGCCAAGGACACAGCTCCCG
CAGCGACAACGAACGGCAACGGGACCAAGCGCAAGGCCGACACACCCTCTCCTGATGAGGAAGAGTCAAAGAAGGCCCGT
ACTGCAGACGAGGTGTGAACTCGGTTCGATGCGCTGTAAAAAGGAGGTCGCTTTGCTGTTTGTTTGTTTGTTTTTCTTTC
TCTCATTGACCAACTCTTGCTCCCCTTTTTGGATCAATCAGGACAACAGACGGTGTAGTCTGACCAGGAGAAACCCGAGG
AAATGGAGGAGTTTTTGATTTACAGGCTTGGGAGGTGTTGCTGTCGACAACAAACGGAGGACAGGTCGAGACGCTTTACA
TGGCTGACTGTAGGAAATCTCTAGTGTATTTACTTCTATGTCAACGTAATTAACAATCCCGAGAGGGCCTCACAGGGCAC
CCATACTGTTTCGACGTACCCTGAATGCCAATCTGTTGAGAGGAAGAGCTGCAATCCCGTTTGGATGTCGAAACGCCAGT
CTGGCCAAGGTTGTGTCAAGCTGACGCTTTGGATCATTATGATGCTAGGCGTCTCTCGTCACGGCCCGATTCTAACGAGA
GTCCACCGGCAGCCGATGGTCATTCTCGGAGCAGAGCCCAGCTGGCGTGACAGCTTCGAGAATCTCTGTGCAAACGGCCA
TTCGGAGAGGGCAGAGGCCCCAGACCCGGAACGTAAGGGTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62