GenePrediction:GLEAN_4745 Details

Name: GLEAN_4745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:648557..646491 (- strand)
Length: 2067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:648557..648431 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_167:648372..648276 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_167:648210..646940 (- strand)
Length: 1271
Type: CDS
Source: GLEAN
Position: GCSC_167:646813..646491 (- strand)
Length: 323
>GLEAN_4745 class=GenePrediction position=GCSC_167:648557..646491 (- strand)
ATGGTGTCTCCCACGTTGTACGTCGTGGCCACGACGGCGGTCCTCTACACGGCCTACTCGATTGCCAGCGGGCTGCGGGC
AAATGTGCAGAAGGCGCGCAGCATCGGGCTGCCGTACTTTGTCGTGCGTGAGTTTTACTGGCGGCCGTTTGCAGATGGTG
ACGATGCTGACGAGGGAGAAAACAGCGTGCTTGCCGTTCAACATGCTCTGGCAGGCAACATGCCACATATGGGTGCCCTT
GATCAAGCTGCTGCCGGCGCGGCTGTGGCAGGACTGGCTATTGTAGGTGCTTCTCTGGATGTCGTGATGAGCTGCTAACT
GGCCAACGCTGACATCGAGGTGGGTAGCATCCTGCAGCCGGATTGGGGATACCGGTTCCAACAGGAGCCATTTGAACGGC
TGGGCGACTCATTTGTGGTAGCGTCGCCGGGGGGTATCGTGCTCTTCACGCAAGACCCCGGGGCGATCCACGAGATTGCA
ACACGGCGGGAGCACTTCCCCAAGGCGACGAAATTCTACCAGGTGCTGGAGCTGTTTGGGCGGAACCTGCTGTCGACGGA
GGGGGCGGTGTGGCGGCTGCACCGCAAGGTGACGAGCACGTCGTTCAACGAGAGGAACGCGGCATACACGTTTGGCGAGG
CAGTGCACCAAACACAGAGCCTGCTAGCAAAGTGGGGATCGGAGGACGGCACAATCATGACGATCGAGGGCGACACGATG
AAGCTGGCACTACACATCATCGGGTACGTGGGCTTTGGGCTGCGGTTCGTGTGGCCGGGTGAGAGGCTGCCGGCGGAGGC
GGACCTGCGGCTAAACAAGTACGGCAGCCTGGAGCCGCCGGCAGGCCACAGCATGACGTTTGCGGTGTCAGTGGAGCGGG
TGCTGCATCGGATTATCCTGCTGCTGATGCTGCCGGGATGGCTGCTGCGGGCGCTGCCGTTCCTGGCGACGCACGAGGCA
TATGAGGCAGGCGACAACTACAGGAGGTACATGCGGGAGTTTCTGACGGAAAAGGCGGCGGCAGTGCGGGCAGGTGACCG
CGGCGAGGGTGGGATGGACATTATGGGACAGCTGGTGCGGACGCAGCAGGAGGACCGGTCGGGCGAGGGCCGGTTGACGG
ACGAGGAGATCATCGGCAACGCGTTCGTCATGCTGGTGGCCGGCCACGAGACGACGGCCAACACGCTGCACTTTACGCTG
CTGGAGCTAGCGGCCAATCCGGCGGCTCAACGAGCGTTGCAGGCCGATATTGACCGGCTGCTGGGCCGCGATTCAGACCC
AGCCACGTGGGACTACGAGGCCAACATCGGGGCCATGCAGACGTCGGTGCTGGGCGCGGCCATGAACGAGACGCTGCGTC
TGATGCCGCCTGTGGTCAACATTCCCAAGTGGGTGCCGCCGGCGATGGGTGGCCACCAGATGCTGACGCTGGCCGGAGAG
CCCCGGGCGTTGCCGGCGGGCATGACGGTCATCCTGAGCGTCATCACGGTGCAGCGACATCCGCGGTACTGGCCGGCGGC
TGGAGCTGACGAGAAGCCGGACGTGGATGACTTTGTGCCAGGCCGGTGGTTCCGGGACGGCGGGGAGGACGAGGACCAGG
ACATCGAGGAGCACGAGGGTCCAGATGCACAACTGAAGCGAGAAGACAAGGCAACGGCACAAGACGCAAGAAAAGCCGAA
AAAGCCGAAATCGCCGAAGATGGCCCGGGACCCGATCAACAGCAGCCGTTTCGGCCGGTTCGAGGCAGCTTTGTGCCCTT
TTCCGACGGAGCGCGCAGCTGTCTCGGCCGTCGTATTGCCCAGGTTGAGATCCTGGCTGCGCTGGCCGTGTTGTTCCAGC
GCCACAGTCTCGAGCTGGCCGTCGACGACTGGGCCGACGACGCCGCCGTGGCCGCCATGGACCCATCTGCCCGCTGTGCC
CTCTATGCCCGCGCCCAGGCGCGCGAGCGCGAGACGTTGCGTGGCGCCCGCACCCTGTTGACGCTGAAGCTGCACGGCGC
CGCGGCCGTGCCGGTGCGGCTTGTGCCACGGGGCGAGGAGCGGTTTGTGCACTTGGTGGACTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62