GenePrediction:GLEAN_4746 Details

Name: GLEAN_4746
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:645895..644625 (- strand)
Length: 1271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:645895..645825 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_167:645645..645433 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_167:645363..644625 (- strand)
Length: 739
>GLEAN_4746 class=GenePrediction position=GCSC_167:645895..644625 (- strand)
ATGACTTCGTGGCTGCGCGCGCAAAAGAAATCCGAGCTCGTCGACATTGCCGAGACCATCGGCCTGAAAAAGTACGTCAC
CTGATGAGCGGGCGTTTGCATGCGCTCGTGCTCGTGCATCGCCATCGATATCGATGTTGATGTTGATGTCGATGTCACGA
CTGTCGTGGAAACGGCATCGCTGTTGTTCTTCTTGCGCGCGCGTTCTCATCAGTCCTCGGGCGCGTCAACACAACTAACA
CGTCCAACAGTGTCGCGAGCTTGAAAAAGGCTGACCTCGAGTCCTCCATCGACGAATATCTGACCGAGAATGTCTCGCGC
CTGTCGTCAGATCCCAAGCTGGCGCCCTACTACAACACACGCGGCAAATCGGGCAGCTCGCCCATCAAGCGCGAGCCTGT
CGAGCCCAAGGTGTCAAGACGCCGCATGACAAAGTCAGCCCTGGAAGAGATCGTGGCTGCCGAGTGCGTCTTTCGGTCTT
GTGTCTTTTTCGCAGCGGCCAAGAAGCCAAAGTCAACTAACTACTCTTGCAGTGACGGCACACCGGCCGGCCGATCGTCC
GCTCTTGCTCTCACCCGCACGCCCGCCCGCACGCCTGCTCGTGCGCTGTCGTTTGCCAACCGCATCGCCATGCCCTCGTC
TCCGGCTGAAGTCGTCCAGGTGGTCGATCGCGGCGCCGTCGCCGTGCGCGAGCGCGTCGTCTCCATATACGCCGACTCGG
GCATCACTGAAGTCACTCAGGTGACGCGCGAGTCGCTGTCGACTGTCAACGCCATCATCGGCCTCGTCTCCCTGTTCGAG
TGGTTCTTTCTGCGCCCTGAGCTCATGGCCAACCGCTACGCCTTCACCCTCCCGGCCATCGGCTTCCTCGGCACCAGCGA
CTACCCCGTCCAGACGCCCGACTTCAGCGTGCTGCTCTCCGCCACCTTCTGGTCGCCCCTCCTCGTCTGGCTCTTCGTCG
GCACCCTCGCGCCCGCCCTCTTCGGCTTCTTCTTCAACCTCTCGGCCGCCAGTGGCAGCCACCACAGCGGCCGCGGCCGG
TCGCGGCCTTTTTCCAGCGCCGAGTACATTGTCGACCCACTCACCTTTAGCGTCGCCAAGGCCCTCCTCGTCTTTGTCGT
CCTGGCCCAGGGCGCCACCTTTGGCGGTTGGGTCGACGGCTTCTCGGTCGCCCGCATCAACTCGGCCCTGTACGGCGGCT
GGAAGGGAGCCCTCGTCGGCACTGCCATCACCGGCCTGGCTAGCCTCTACGATGCCGTGTTGCGCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62