GenePrediction:GLEAN_4747 Details

Name: GLEAN_4747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:627571..626629 (- strand)
Length: 943
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:627571..627385 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_167:627279..627075 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_167:626978..626770 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_167:626699..626629 (- strand)
Length: 71
>GLEAN_4747 class=GenePrediction position=GCSC_167:627571..626629 (- strand)
ATGTCGGGCGTCTGGGGCTGGTTCGGTGGTGGCGCATCCGCACAGAAGCGCAAGGACACACCGAAGAACGCTATTCTCGG
ATTGCGATCGCAGCTTGATATGCTACAGAAGCGAGAAGAGCATTTGCAGAAGCAGATGGACCAGCAGGATGCCATTGCTC
GAAAGAACGTTACAACAAACAAGTCCGGTATGTGCTGTAGAAGAAAGAGAAGGTTATCGGGAGATATGCGATGAAGGCGG
TGGCGAGGGAAGATCCGCAGAGTATACAATATTGTAGCTAACCATCGAAAAGCGGCGCTGGCGGCACTACGGCGCAAGAA
GGCGCTGGAGCACAGCCTGGAGCAGACACAGGCCCAGATAGGCACGCTCGAGCAGCAAGTCAACGCCATCGAGTCGGCGA
ATATCAACCGGGAGACACTGGCGGCGATGGAGCGGGCGGCCGCAGCCATGAAGACGATCCACGGCAACCTGACGCCGGAG
AAGGTCGACGCGACGATGTATGTTTGGCTTCTAGCCCTACCTCTTCCCGTCGGTTCTCTGTTAGATTGGAGTCGTCTCGC
AATTTTGCTCCTACATACTTACATGTCTACCAGGGAGGAGGTCCACCTGCAGAACCAACTCAGCGAGGAGATTGTCACTG
CCATTACGACTAGTACGATTGGAGACCTTGTGGATGATGCCGACCTGGAAGACGAGCTGGACAAGCTGCAGCAGGAACAG
CTGGACAACAAGATGCTTGAGACCGGAACAGTGCCAGTGTCGGACGCCATCCACAGGCTGCCGGCAGCAGCAAACGGAGA
GAGTAAGATTCCCCCTTGTTCGCAATACCCCTGGTTCTGGTACCATTGAGCCACTGTCTAACACAATACCAGTCAAGAAG
GCTGTGGAGGAGGACGACGAAGAAGCGGAGCTTCGGAAGCTGCAGGCCGAGATGGCTATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62