GenePrediction:GLEAN_4748 Details

Name: GLEAN_4748
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:622758..612307 (- strand)
Length: 10452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:622758..622470 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_167:622400..612307 (- strand)
Length: 10094
>GLEAN_4748 class=GenePrediction position=GCSC_167:622758..612307 (- strand)
ATGGCGACTGCAGCTGAAGGTGGAGTCTTGTTCAGCGAAGAACGGCTGTTCAATCCTCAAAATATTCAAGTTGCCAACTA
CGATATGCCCGATATCGCAAACTTCAACAATGTCGAATTCTCAAAGGAAATCAACTCTGAAGAAGAGGACTTTGAGGAGG
AAGATCTTGATATCGACGAAGGCACCCGAAATGGACAGCCTGATGTCGATACCGAAGTGAGTATCGAGTCGGAAGAGCCA
AAAGCACAGGACCAAAATGGCAAGGACAAAGAAGCCACCAAAATAGAGGGTACGTTTTCAGTGGTAAATATCAATTTTAC
ATGCGGAGAGTTCAGGACTGACGCTGACACGAACGAAGATAACGACTCGAAACCGTCAACGCCCAAGAAGAAGTCAAAGA
AGTCAGGCAAAAAGCACAAGAAAGCTGCTTCTGTCGAAACCGAATCTGAGAAGACAGAGTCACCAACTGAAGAAAAGAGT
GAAGGTGACGTCAAAGCGAGTCCCAGCGGGAAAAAGAAGAGCAAGAAGAGCAAGAAAAAGAAGTCGAAAACCAGTATGCA
GTCAGAGTCCAAGGCTGGCAGTTCGACACTCGATGATTCTACAGATTCGGCAGAGCCGCAAACCCCGGAGCAACAGCAAA
TACATGAGTCGAAAGACGTCGCAGCTGCTGCCGTGACAGCAGAAGCAGCAACTGAGGCAACAAACGGAACCGAGATGGCA
AAGGAAGTTGCCCCTGCTGTCGTTGAAGCACCTGTTACCGTCGAGCCCGCCACTGAGGCTGCCGCTGAGGCAACTACTGA
GGCTACACCTGAAGAAATCGCCGATTTCATTGTCGAACCGGCTATCGAAACTGCCGCCGAGACTGCCTCTGTAGAGCCCC
AGGAAGACGTTGCGCCGACCAAGGATGCTTCTGCAACAGAGGACCCTTTGGCTGAAACTGCTATTGCTGAAGCAGAAGGA
GAGAAAGAAGCTAAACCGCAGGCAACTTCTGGCACTGAAGAGCTGAAGAAAGAGTCTGAAGTGAAGGCGACTGCGGGACC
CGAGTTTTCCGAAGCTGAACAAACGGCACCAACCGACGAAGCAAACGGCCTCGCAGAAGACACATCCGCCGTTGTTGCTA
AAGAGCCAGAGCAGTCGAACGTTGACTCCGAGGACCCCAAAGTGCTGGAAACAACAATTGCGACTGAAACCGATGTTGCG
GCAGATTTCACCATTGCTGAGATTGCGGGTGAAATTGAGGAGACGTCTGACTCGCCAGCTCCCACTGAGTCTCATGTTCA
GGAAGCAACCCCAGAATTGACAACAGACTCTGCCAAAGAAGAGTCTGTGCAGGAAGCGCCCAAGGAGGCAGAAGATAAGC
CTTCGGAGGCGCCCACCAAGACCGAATTGGTAGAAGAAGCGCCATCATCAACAGCGGTTGAGCCAGAGGAGCATACTGCT
GAATCAGCATCTACAGAAGTGTCCACGGACGCTGTTGCGGACGAAGAAGCCAAGAAGTCTACGGAGACGGAAACCGAGGC
CGAGGCCGAAGTTGAAGTGCGCGGCGAATCTAGCGCAGCGGCGCCAGAGCTTGTCTCGGACGCGGCGCCCGAAACTCTCC
AATCTGAATCTGAAGCTTTGGAAGTTGTTCCCGAGGTTGCTTCTGAGGCCGTGGTTGAGCTTGCTACCGAAGCTGCTCCT
GAGGTTACTCCTGAACCCAAAGTCGAGGCTGAGGAAAAGCAGGAAGAGGCATCGACTGAGAAGGCAGAGGAAATTCTGGC
TGCCTCGAGCCAGGATGTCGAGTCTGCCCCTGAAGTCATGACTGAGAATGAAGCTGTGACTGAGAATGAAGCTGTGGCCG
AACCTGAAGCCATGGTCACGCCTGAAGCCGCGGTTGAGGTTGAGTCTGCCCCTGAAGAAGTCGTGACCGAGCCTGAAGCC
GTGACTGAGGTTGAAGCTGTGGCCGAAGCCGAAGCCACGGCCGCGCCTGAAGCCGCAGTTGAGCCTGAAAGCACCCCCGA
AGAACTCACGGGAGCCGCGGAAGAGACTGTGAAGGAGGCCGCCGAAATTGAAGCTCCTGTCGAGACGCCTACTGAGGAAG
ATGCGGCTGTTCACGAGGAAGCAATCGAACCTGTTTCTTCTGGCGGCAAAGCTGTATCTGATACTGCACTTGTGGATGAA
TCGGACGGAAAACCAGAATCGGCAGAATCAGTTGCTGGGCCGGCCGAGACAGCTGAGGAGAGCACGGCAGTGGTAGAGAC
TTCTGAGGAAACGACGGAAAAGCCCCTGGAGGATGTCAAGGAGCTAGAGAAGTCTGAAATGGTCGAAGTCGAAGCTGCCG
CAGCAGACGGAAAGCCTTCCGAAGCGGCTGAGAAAGATGTGGAGACGACTGACGAGGTTCCCGAGCCATCAAAGGAGGCC
GAGGATAGCCCTGAAGTTGTCGAAGAGGAGGCTACAACGACAAGTGACGAAGCAACAGTGTCCACCGACAAGAAGGAAGA
GACGGATACCGTTTCTACTGCTGATGAAACTGAGAAACTTACTGGAGAAGTCGCCGAATCCGAGCTGCAGGTTGTTGCTG
AGCCGGTGACCGAAAAGACTTCCGAAGACGAAACCCCCGAAGAAAATCCAGCACAGGAATCAGTTTCCAAGACCGAAGCC
GTCGAGGAGGATTCTAGAGAAGCTGTCGCCCCTGTCTCCGAGTCTCCCATCACAGAAAAGACCGAAGCTCCTACTGAGAC
TACCGAGGCAGTCCTAGTGGACGAAGCTGAGACTGCCCTTGAGGAAGGCAAGGCTACACCTGTGGAAGAAGCTGAGGCCC
TTGCGCCAGTTGAAGTAGCTAAGGTTGAAGCTGCTCCCATCGAGGAGGCTGATGCTGAGGCTGCACCCGCAAAGGAAGTC
GAGGCTGAAGCTGCTCCCACAGAGGAAGCCACCGTCAAGGAGGTCGAGACCGCACCTGTCGAGAGTGTCGAGTCTGAAGC
CGTTCCTGTGGAGGAAGTCGAAATCGTTTCAGCTGAGGAGGCGGTTGAGACCGCTCCTACTAAGGAAGCAGAGACTGTTC
CTGTTGAGGAGGACAAGGCATTCCCTACTGAGCCTGTCGAGACCGAGGCTGCCCCCGCCGAGGTGACTGAGGCCGAGGCT
GCTCCTGTTGAGAAAACTGAGGCCACCCCAGCTGAGGAGGTGGTTGAGTATTCTTCTACTAAGGAGGTCGAAACTGCTCT
CGTGGAGGAAGTTACAGCTGAGGAGGTCATCGAGGTCGCCCCTGTTGAGGAGACAAAGGCTACTTCTGTTGAGGTGGCTG
AGACAACTCCGGTTGAATCTGAGGCTGCCCCCGTCAAGGAAGCCGAAGCTGCACCTGTGGAGGATATTGCAGTTGATGAG
GTCGTTGAAGCTGCCCACACCAAGGAGGACGAGGCTGCAGCCATTGAGGAGGTAAAGGCTGCCCCCGTTGAAGAGGTCGA
GACCAAGGCTGTTTCTACAGAGGAAGTTGCAACTGAGGAGGAGGTCGCCCCTGTTGAGGAGACACAAGCTGCTCCTGTCG
AGGTGGCTGAGACTGCTCCGGTTGAGACTGAGGCTGCTTCTGTGGAGGAAGTTGCAGTCGAGGAGGTCGTTGAAGTTGCT
TCCGCTGAGGAGGCCAAGATTGCAGTCGTTGAAGAGGTTGAGGCTGCCCCTGTTGAAGAAGTTGAGACCAAGGCTGCTTC
TACAGAGGAAGTCGAGGTTGCTCCCGCCAAGGAGGCCGAAACCGCAACAGTAGAGGAAGTCGCAGCTGAGGAGGTCGTTG
AGACTACCCCCGTTCAGGAAGCCGAGACTGCTCCTGTTGAGACAGAGGCTGCTTCTGCAAAGGAGTCCGAGGCCGTTCAC
GTCAAGGAGGCCGATATTGCTCCGGTGGAAGACGTTGCGGTCCCTGTCGAGGTTGAGACTGTCCCCGTGGAGGAGGTCGA
GGAATCCTCCGTCGAGGCAGTTGAAGCCGAAACTGCTTCAGCAGAGGTCGACGTCGCACCCACCAAAGAGGCCGAGACTC
TGCCTGAGGCTACACCTGCCGAGATAGTCAAGGCCGAAACTACTCCTGTCGAGGTGGTTCAGGAAGCCCCCGTCGAGGCA
GTCGAATTTGAAACTGCACCTGCTAAGGAAGCTGAGACTGCATCCGCCGAGACAGCCGAGGTGGAAACAATTCCTGCCGA
AGGGGTCGAAGCTGCCCCAGTCGAGGCCGTTGAAATTGAAGCTGCTCAAGCAGATGAGGTCGAGAGTGTTCCTATTGAGG
CAACCGAGGCTGTACCCACCGAGACAGTCGATTCCGAATCTACTCCTGTCGAGCAGGCCAAGGAACTCCCCGTCGAGACA
GTTGAAATCGAGTCTGCTCCTGCGAAGGAAGTTGAGGCTGCATTTGCCGAGACAGTTGAAGCCGAGACTGCTTCCGTCGA
AGAGGTCAAGTTGGTCCCCGCTGAGGCAGTCGAATCCGAAACCGCCCTTGCAGAGACCATCGAGGCCGCAGCCGTTGTGG
AGGCTGAGACCATTTCTGTCGAGGACATCAAGGCAGTCCCCGCCGAATTCGTCGAGGCTGAGACCACTCCTGTGGAGGAA
GTTGAGGCTGCTTCTATCAAGGAGGCAGAGGTTACCCCTGCAGAAGAAGCCGAGGAGGCCCTTGCCGAGGAACCGAAGGT
TGCCACCGCAGAGGAGGTCGAGGCTGAAGCTGCTCCTACAAAGGAAGTCGACACTGTTGAGGAAGCTGAGACCGCCCCTG
TAGAGGAGACAACAGCCGCTCTGGTTGAGGTAGCTGATGTTGAAGCTGCTCCCGTTTTGGAAGCTGAGGCCACTGCCGCC
AAGGAAGTCGAGGCTGAAGCCGCCCTTGTGGAAGAGGCTCCTGCTGAGAAGGCCGAGGCTGCTCCTATTACGGAGGCCAA
GACCGAGACAGTCAAGGAGGTTGAGGCTGCTCCTGCAGAGGAGCCTAAGGTGGTTTCTTCTAAGGAGCCCCACTCGGCCT
CAGTGGAGTCTGCGGCAGCATCTGTGGAAAAGCTCGAGACCGTCCCTGTGGAGTCTGTCGAGGCTGCTTCTGTGGAAGAA
GTCAAGGCTGCGTCAGTCGAAGAGACCGAGGCTGCGTCCGCTAAGAAAGTTGAAGACGCCCCGGTAGAGCCTGTGGAGGA
AGTCGAGGCCACCCCTGAAGTTGAAGCCCCCGTGGAGGTTAAGGCTATTCCTGTAGAGGAAGCCGAGGCTGTCCCAGCGG
AAGAAGCTGCTTCTACCGAGGAAGCTGAGGTCACCCTCGTGGAAGAAGTCAAGGTCACCACCGAAGAAACTAAGGCTATC
CCTGCTGAAGAGGCTGAGGCTGCTCTTTTTGAGGAAGTCGTTGCTCCTGTTGAGGAGGCCACGGTCACACCCACCAAAGA
GACTGAGGCTGTGCGCCCCAAGGATGTCGAAGTTGATCCTGTGGAGTCGGAGGAGGCAGTCGAGGTTGCTGCTGTGGAGG
AAGCTGAGATCATCCTTGTCAAGGATGTCGAGGCTGCTCCCACGGAGGAAGTCGCTGCTCCTGTTGAGGAGGCCGAGACT
ACCCTTGTGGAGGAAGTTGAGACTACCCTCGTAGAGGAAGCTGAGACTACCCTTGTGGAGGAAGTCGAGACTGCCCCTGT
GGAGAAGGCTGAAGTCGCCCCTTTGAAAGAAGTCGAGGCCACTATTGTGGAGGAGACCAAGACTGCCGTTACAGAGGAGG
CTGAAGCTGCCCCAGTGATCGATGTTCCGGTGGCCGAGGCCGAGACCGCCCCTGCAGAGGAAGTCGAACCTACTACTGCA
AAGGAGGTTGAGGCTGCCCCGGCAACAGACACCCCCGTGGTCGAGGCTGCTCCCGAAGCTCCTGCTGCAGTGGAAGCCGA
AGCGGCCACAGAGAAGCAACTAGCAACAACGACAGACGAAGTCAAGACAACAGACACGGCGGAATTCACCACAGCCGACA
AGATTGCAGCGGCAGCTGCAGCGGTAGCCGTGGCAGCGACAGCTGCAGCAGCAAGCGCAGCCACTGAGGACAAGAGCCGG
AGTATTAAAGGTGAGGAATATTCCCAATTCATTGCTGATCACACCCCCGAAGGCGAAGGAGCCAGAGAAGAGGAGGAAAT
GCACAGCCCAGAAGAGAAGGAATTCGAAGAGAAGGAATTCGGCGGCTTCCCTCGGAACGACGAGCTTGCGGAGAGTGATA
TGAGCGACAGCGGAACTGCTGCCACATCTGTCGCCGATGCTGCCAACCCAGAAGGCCTTGTTGAACCAAAGGGCATCGAG
AATGCAAAGGAGGCAAGCGTCTTAGACGTTGTCGCATCAGAAGAAGTAACGGTTAACACCGCCGTTGTGTCAGAGCCTGA
AGCTGTCTCCTTCTCAGATGCCCCGATCAACAAAGAGGTGGAGGCTGTCGAGCCGAAGGCCTTACTGGAAGCCGCTCCAA
CAGAGGTGACAGTGCCGGTCTCCAAATCTGGCAGTGAACTGCCAGAGACATCAGCCAAGGAGATCTCTGCAGCAGACGAT
GTCCAGCCCACTCAAGAAGCACCTCTACCAGAAGCCGCCAAGTCTCTTGAAGTTACGGAACAGCCCACTGCGGACGATGC
CAGCGAAGAGGTCGAAGAGTTCGAAGAGGCCGAAGAGGCCGAAGAGGCCGAAGAGGCCAGAGAGGCCGCAGGCACTTCAG
CTGTCGACACCGACAGCGTGGCGCGGGAAGAAGCGTCAGCAGCAGCTGCTGCTGCATCAGCCGCCGCGATAGCAGAAGGT
GATATTCAACTGAAATTCCCCGGGTATTCTGCCCGTACCACATTAGAAACAGGCCTTGTCGTTACTGACGATAAGCCTGA
ATCTAGTTTGGCAACAACCAGGGACAATGAAGGCGTTCCAGAACGGATTCCTGCAGATCTTTACGATGATGGGAGTGGTT
GCGCTGTTTCTGCCGAGAAAGATGTTCTTATTTCTGAAGCGGTAGCTTCACAGCTAGCCAGAGATAAGGCCGAGGGTCAT
GTTCCTGCCATCGTGCAGGAAGGGCAGGTCCTAGTCGAGGCTGTTATCGTTGAAGATCAGGAGACACCATCCGAAGCAGT
TTTGCCGGAAGGCTCAGACCACGTGGACCACCATTCCCTGCCTGCCAATGCCGTGACAAGAAACCAGAACGCAGTTGAAG
AGAAAGATGTCCGAGAACGGGCATTATGGCAGGATGCAAGCGTTGTTGGTGTCAGCTCTGCAGCTTTCAGGGATGAAGAG
CAAACGACAGCCATCAGAACCCCCGTGGCGATGTCAGAGCTCGAGCCCGCCAAAGTGCCGACTGATGCTGAAAAGGCTGC
TGTTCCTGAGGTCGAGACTGATGCTGAAGCAACTCCCGAATCGGGTGTTGGAATTTCTGTCGTTGTCTCGGCCGCTATGG
TGACCGAGGATACTGCTCAGAATGTCGCTCATTATGTTGCAAACACTATGCCTGCTGTTGCGATGGAACCAGCTGAGGCG
GTGTCTGGCCCTGTCCTTGCACAATCTTCTGAAGCCGGCCTGAGAACTTCTACGGACGCCGAGGACGGTGATGCGACACA
GTCGGTGGAGCCCAAACCTGTCGACATTGAGCCGGCTTCCGGGTCTTTTGAGCCCAAAGCTACTGGATCTTGTCTTGAGG
ATGACGCTTCTGAGATTCAGACTTCTGAGACTGCTGCTGAGGCCGATCCGATCGAACTGGATGGTATTGCGAAAGATGTG
CCTGCTGTAGTTGAAACTGCCAACTCCGATGATTTTCCAGACGACAGCACGACTTCACGATTTGAACAAACTATACCGAC
AGAATCAAGAAACCAGGCGGCACCAGCATATCCTGTGGTGGAAATCGCGCAAAAGCCAGCTTCTGACGAGGAATATGTCC
TGGTCAAGGCCGTTGACGAAGCGGCTACTACAACCCCAGGACTAAGGTCGACTGTTCCCATGATCGACATTCCCTTCAAC
GACTCTGTGCCCGCGGTCAATGTAGCGACACTACACGATACCTCCAATGCTAGAGAAGAGCCAGAAAGCTCAACGTCGGC
TCGTGAGTTGCCTGCGTTTGAAGCTGGCATAATCGAAGAGGACAGTTTCGTCGCTGTTGATGCAGCAGGCAGCAGCGGGC
AGTGCGATGACGCTCCAGTAGACGAGTCTTTTCAAGAGGAGACATTTGCAGGGGTAGAGATTGCGGCAACACTGAGTGGT
GTTGGATTGGCTGAGATGGCTGGTCACTCTGTAAGCAGCGAAGATGAACAGCGCCCTCGTTCAGCCAGCTCCATAGACAT
TGGATCATCGGGCGAGCTTGTACTCCCTGAGGATGTTCGATCGATCAACTCGGGACTCGACTCTTCGCAGGTGCTCGAAG
AGCAGACCATGCTGTCAATGTCCAACAGCAGCGGGAGCCTTGTCCAAGACGCCTGGACAAGCTCCAAAGACGCGCTCCAA
GCGCCGACACCGACAGTCGTGATTCCAGATCTGCAGGATGCAGTAGCCATGGGGCTGGGCCGGGTACGGAGTAATGGGTT
GGAGCGGGAGCTTTCGGGAATGTTTAAAGATATAGAGGAGAAAATCGCGGCAGTGGTGGTGATTTATGCAACTGCAGAGG
TGCTGAGTCGGCCCGGATCGCCAACAACAGCGGAGGAGATGGAAAGAGCAGAAGGAGTGAATGAGATAACGGGGCAAGAA
GAGACAGAGCAGGCGTGGGGGACAGCCGGAGCAGAAGGGAGGAAGTGGAAAGGGAAAGGGAAAGAAATTGCAGGAGCGGC
AGAAGTGGCAAAATGGATGGCAGAGACAGAGGGAGAGGAGGATTCCCCGGCGGCCGAGAAGAGGGGTTTGGAGGGAGAAA
GCGCACTGCGCGATTCTGTAGCTGACCTCTTCGCAGACGAGAAGCTACGAGGAAGTTCCTCGGAGGCAGTGCCCAACATG
ATGGCAGCAGGAGCAGGAGCAGCAAGGAGCTCACGGCCGCGAGGAGAGCACTCTTCTTCTGGCCACCATTCTTACTACAG
CAGCCGTGAGGCAGATCGGGATAACAGAGACAGCACGACCGGTGGAGAGATGCCGCGACACGGACGTCGACACCGGCAAC
GCCCGAGCAGCAGCAGCCATTCGGTGCCGTCGGGATCGGAGAACTCACAGCCGAGGGCGCCGGCGCGCATAGCTGGCGGC
TTCTCGGGGCAGAGCGGCCAGAGCTCAGGTCCGGTGTCAGCTTCTCGCAGGTCTTCGTACCACCGGCATCATGGAGAGGA
CAGAGATCGGGAGAGAGAGCGTTTGAGAGAGGGGGAGAGAGATCGAGAGAGAGATCGGGAGAGAGATCGGGTGAAAGAGC
AGGAGAGAGAGCGGGAGAGAGAGCAGGAGAGAGAGCACTTGAGAGAGCGCGTGAGAGAGCGGTCAGAGAGAGAGCGTCAC
GAGAGAGAACGACCGGAAAGAGAGCGTTCTGAGAAGGAGCGCCACGAGAGAGAGCGTCACGAGAGAGAGCGTCACGAGAG
AGAACGGGCGGATGATGAAAAGGAGCGGCTGCTGCGCGAAGAACAGGAGGCTCACGAACGACGCAGAGCCGAGAGACGGG
CGCGGAAAGCGCGAGAGGAGAAGGATAGGGAAAGGGAAAGGGAAAGGGAGAAGGAGCGAGAAAGAGAGGCGGCAATGGGC
GAAGGCTCATGGGCTCAAGGAAGCAGACGCAAGGAGCCAGATGTGGACAGATTGCCGAGAGAGCGACACGACGAGCGACG
GGAACTGCGGCATTCGTTGAGCAACCGGCATTCGTCCGGCCATCGACACTCGCGGCCATCAACAGGCGATGCCAGCACGC
CAGCTGCCAGCACAGCATCCAAAGACACTGATGTGCCTCCGATTCCATCGACGGTGTCGAACTCGACTTCGGCGTCGAGG
CCGTCGACCAGCCGCAGACTGGCAGAGCCCGGCTTTCCCTTGCGAGACAGCATCGCTGCTACTGCCGAGAAGAAAAGGGT
GTTCCGGGACGGAGAAGAGACAGTGCCGATCAGCTCCGACAGCCGAGAACCTGTCAGGCGCTCAGGCACTCTCCGATCGA
GATTTGGATCGCTCAGACGGCCCAAGGACGACGGCGAGATGCAACCCAGCACGAGGCAGCCAAAGAGCAGCAGTGACCAC
GTACCGACGAGCCATCGGCATAGTCGTCACCCTAGACAGAGCGTAGAGGTCGAGCGTCTGGCTACAGCTGTGAGACCGGC
TTCGGCTCGGGTTTCACTCCCAATTCCAATGCCGGTCTCAACTGCAACATCGCGACGCAGGAGGACGAGCGACGCGCCAG
CAGTTGATGTCTCAACTTCAGCTACAGCAGCGGCAGAGGTGCACGAGTCAGAGCCCAAGGAAGCCAAGATGACGGACGAG
AAGCATCGCAGAGACCGGCTGGAGAAGCGTGAGCGCAAGGCCAAGTCCGACAATGAAAAAGTCAGGACGGATGGCGAGGG
CAAGAAGACGGGATCAGGCCTGCGGGCCATGTTTAAGCGGTTTCTCCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62