GenePrediction:GLEAN_4749 Details

Name: GLEAN_4749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:610768..609871 (- strand)
Length: 898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:610768..610725 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:610656..610243 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_167:610171..610147 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_167:610047..609871 (- strand)
Length: 177
>GLEAN_4749 class=GenePrediction position=GCSC_167:610768..609871 (- strand)
ATGACCGAAGCGGAAAATTTCGACGACGAGCTCTTCGCCGACTTGTCAGTGAAGTCCCAAGCCGAGTTCCTGCTTTTTCC
GATGGGGCACAACGGCTGACCCACGTTCGCAGATACGCCGACGATGAACCAGCCGCACCCAAGGTCGACTCGGGGCTGGC
GCCGTCGACAACGGCTGCGGCCACCAACTTCGCTGCGGCGCCCGTGTCAGCTTTTGCTGCCGCCGTGGAACCAATGTCGC
GGCAGTATGACAACGGAGGCAACGAGCCGAACGGCGGCGACTACGACGGCGCGCGAGAAGAATATGACGATGACGATGAC
GAGGTGGACTTTAACCTCGGCAACGGGAGCAGCAGTAATAACAACAACAACGGCGGCGGCAACATGAACAGCAACATGAA
CAGCGGCGGCGGCGGCGGTCAGTCGCACATGGAGTCCACGCCGCCCGTGAGCAGTAGCAATCCGTACCACGGCGGCGGCG
GCTCGGGTGCCCCGTTTTCGCGTGGCCCCAACTCTAAGGAAGATGGGTGAGTACTGTGCTTGATGCCTTTCGTTTTCTCC
TTCTTTCCTTCTTCCGTTCTTTCGTGGCCGTGAACAGGCAAGGCAGCAGAGTGGGAGGAAGGGTAAGACGACGTATGGAC
AGCACTGGACAGGTGAGGACCGGCTTGGCGGATGATGGGTAAGGCAAAGACTTGGGTATTGGAAGCGAACTGGTGGGCCA
GCAAATGAAGATCATGCAGAGGCCGACGCAACCGCCGAGCAGAGAGAAATACAAGGCATCGCGTCAGAAAAGCCATAGCG
AGAGTCAGAAAGAAAAAAAGAACGAGATTCTGCAGCACTCTCGTGCAGGAGAAGCACGGGAGCCGCAGGGGAGCTTCGCA
CAGGCGGACAGCGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62