GenePrediction:GLEAN_474 Details

Name: GLEAN_474
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:57867..60562 (+ strand)
Length: 2696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:57867..58007 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_97:58075..58213 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_97:58293..60562 (+ strand)
Length: 2270
>GLEAN_474 class=GenePrediction position=GCSC_97:57867..60562 (+ strand)
ATGGCCGTTGCAGCGCTGCTTTCTGCTGTCCGAGAGCTCGCGTCCAAATATATCTGGCCCCGTCAGCCCGTGTCGCAGCT
CTGCGAGCCAGGCGCAATCTGCGCGTCTCAAGACAAGACTCAACCGGCCCCTGCCTCCCAGGTTTGTCGTCTGTCTTTCT
GCGAGGAGATTCGCCCCTGAACAGAGACGGGGAACCAACACGTTTCAGACTAGCACGAGTCTTGCCTCCTGGGCTGTTTG
GCTGCTCAGCTGGCTACGCGCCACAACGGCTGCCATGCGGTCAGAGGCCCTCATCGAGCTGTTTCGAAACGGCTTTTCCT
TCATTTCCGAGCGGCTCCTAAGCCACGGTTCGTGCTACCGACCCCTCTCCGCGTGTCTGCATCGGGCCGTTGTGCCGATG
TGTATCGCTGACAGCTTCTCATACAGCGTCCACCGACGAGAACCCCCTGGAAACCACTTCTCAGATAGCCCTCACAGTCG
ACCGCATAAAACCTCCGCTACCCTCCTCCTCGGACAGCTCTCCCTCCTCGTCCGCCCCCCTCTCCTCCCTCTTTCGCAAT
CCCGACTACGAGACCGTCTGGCGCGATGACGTACACGAATACATCACACCGGCCGGCTTTGAGGCGGTCGCCTCTTTACT
GCGTGCATGGGGCGATGACATCGCGGCGGAAAACATTTCGCGCTGTCGGGAGTCGGGGCCCATAGCCGGACGGTTCGATG
GCGGCAGCCGTGGGGAGACGCGACTCTCGGTCGTCATACACAACCTGATGCTGGACCTCTATGGCTACAACACGGAACAG
GCGTGGCAAGAGACGGTGGCCGAGCTGCTGAAGGATCTTGAGGCCGCCTCAACGTGGATCGAAGTTTTTTACGCGCCCGA
GAACCTGGAGGCGATGAAGATTGAAGGCGTCGTTCCGTACGGGCAGCTGAGCGCGTCTGTTCAGCAGTACTGGGGCCACG
GTTGCGGGCTCTGCGAACTGGCTGGATTCTTTTCCTTTTCAATCCTGCAGACGGACCAATGGGGCCACCCGGGCATGCAC
CTCTCGCAGGTGTCGATGATGAAGATGCTCGTCGACCTGGAGTCCCTTCACCACCACCGACCGATACTGAGCTTTGTACG
GATCGAGAAGGAGGGCCGGCCGCCCGGACACCTTTACGACGACGGCGGGGCGGTTCTGGAGGCCGTGACGGCAAAGCAGC
TGCACGATGTCTGGCGCTACAGGATAGACGCTTCTACGAGCAGCGAGCAGGCACGGCCTCGACAGCCATGTTGCCTACAT
GCTAGCGGTGGCGTGGAGCGGCTCTCGGAGGCGGCCATCCGTCGCGCAAGGATGGTGAGCGCGGCCGCAGCATCGATCAA
GGCGGCACGACGCTGCACAGACGGCAGCCGGCCGATGCGGGTGGCACCATCACAGTCGCTGCTCGCTGCTCGATACCGAA
GGACGTCGGGCTCTTCCAGCATCTCGGCGCACGATGGGCCAACTGTCCGCAAGACGTATCCGATACCGGCCAAGCGCAAG
GCAGTCACGGCCTCAGCAGACCCGAGGCATTTCAAGCGTGGCCGTGTGATCAAGGAGCTGGCGGCCGAAATCGAGAGGGA
CAGGGCCGCAGAGGTGGCTGCTGCTGCTGCGATACCATTGCCACCATCACCGGCAGCAACGGAGCTAAGCTTTGAAGAAG
GCGAGGAGAAGGGCGAGGCTGTCGATGTAGACGTGGAAGACGGCGAGCGACACCGGCTTCCGTGGGAGAGCATGTTTCCG
CTGGACGAAGAGGACGGGCCGCGACTGAAGATCAGCAAGTCCAAGGCAGAGGAGCTGCGGCTGATTGCCGAGCAGAAACG
GGCGGCCTTGCTGGAGGCGCGGCGCAAGCGAGAGGAGGAGCAGCGACGAAAAGAAGAGCTGCGGCGACGGAAAGAAGAAG
AAGAGCGGCTGGCGCGATCGGGACTGCGTCCGCCGACAAGACCGGTGATCCCACCGCTGTCAGAGTCATGGTACGCACGG
GTGAACGCGACGGTGCGAGCAGATCCTCGGAGGGAGGTGGCGCGGTCGCCCGAGGGAACAGCTCTCAAGAGCTCCGACTT
CTGCACGGTGGTCAGCAAGTCGGAGTGGCTCAACGACGAGATCGTCAACGGTTTCCTGCTGCACTTGGCCAACTACATCA
ACGCCAAGGCAGGCATTATGAACGTCAAGACGCAGACGCCACGCTGCCACGCCTTCACGTCCTTCTTCTGGAAGTCGCTC
TCGACCAAGGGTGCAGCCGGGACAGAGCGCTGGATGAAGCGAGTCGGCGTGACGCGCGACAACTTTCTGAGCATCGAGAC
GATCCTGATCCCGATCTGCGAGCGCAACCACTGGACCCTGGTGGTGGTGCGGCCGCGCCAGGCCACAGTGACGCACATGG
ACTCGATGGGCAGCGTTGCGGGCAGGCGGCCGGTCCTCGACATTGTCATGTGTTGGGTGCGTGACTTTCTGCAGGACAGG
CACTCGGACCGGTGGCGGATGCAGCCGCTGGTGTCACCGCGCCAGACAAACGGATGGGACTGCGGCGTGCACACAGTCAC
CAACGCGCTGTTCGTGGCCCTGGGCTTGGATCCGTCCTTCTACGGCGCCAAGGAGATGCCGCTGCAGCGCGACCGGATCG
CGGCCACGCTGATCAACGGCGGCTTCTTTGGCGACCTGGACCTGGCTGGGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62