GenePrediction:GLEAN_4750 Details

Name: GLEAN_4750
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:609485..607466 (- strand)
Length: 2020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:609485..609364 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_167:609033..608993 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_167:608933..608770 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_167:608713..607466 (- strand)
Length: 1248
>GLEAN_4750 class=GenePrediction position=GCSC_167:609485..607466 (- strand)
ATGGGCCCGGGCAGCTTCTCAACGGACAGCTACATCCCGCTAGATGACATGGACGAGAGCGGGAGAAGTGAGGTGCATCC
TGAGGACACCGGTCGGCCTCTCCTGCTTGCCAAAACACAAGGGTCGGTGGTTTGCTGCTGCTGCTGCTGGGCTGCTGCTG
CTGCTGGGCTGCTGCTACAGCTATTGCTATTGCTATTGCTATTGCTATTGCTACTGCTACTGCTACTGCTACTGCTACTG
CTACTGCTACTTCTACTGTTATACTCTTCAGCACTGACTAGATGTCATCGTGAGGCTGGGCGTCGGCTCGCGATGATCCT
GTGACATGACTCGGACTGCCCGACTTTTGTGCCGCCTCTGTCCTGAATGTTGTCTTGTTCTGCTTGCTTTGCGTTTCCTG
TCTTGCTTCTCCTTCAACCCTAGACATACAATTCGCATGCTAACCAGGCCAGGAAAATGTTTATCGGAGGCCTGAACTGG
GAGACGACAGACCGTAAGTCGGACAGACGTGTCCACGCACATGGTGAAGGTGGTGGGGGCTGACGATGACAGAATCGCTG
CGCGACTATTTTTCACAGTTTGGCGAGGTGCTCGAGTGCACAGTGATGCGCGACAGTGCGACAGGCCGGTCTCGAGGGTT
TGGCTTCCTCACGTTCAAGGACCCGAAGACGGTCAACATTGTGATGGTCAAGGAGCACTATCTGGACGGAAAGATTGTGA
GTGGAGGAGAGGGAGAGAAAGGACGAACAGACAGACTGACTTTGGTGGACAGATCGACCCGAAACGAGCGATTCCACGCG
ACGAGCAGGAGAAGACGTCCAAGATCTTTGTGGGGGGCGTGTCGCAAGAGACGACGGACCAGGAGTTCAAGGAGTACTTT
GCGCAGTTTGGGCGGGTAGTGGACGCGACGCTTATGATGGACAAGGACACAGGGCGGCCACGCGGCTTTGGCTTTTTGAC
GTTTGAGTCGGAAGCGGGCGTGGAGGCCTGTCTATCGACGGAGCTGGAGATCCACGGTAAGGCGATCGAGGTGAAGAAGG
CGCAGCCGCGCGGCAATTTGCGGGACGACGACGATGCCAGCCGGCGTGGAGGACCGGGCAACAAGTTCCGCAAGGGCGGA
TACGGCGGGATGGATGAGCAGGGCGGCAGTGGCAGCGGCAGTGGCGGCGGGATGGGCCAGCAGATGGGGGCGGCAGGTGG
AATGACGCCGCAGGTGATGGCGCAGTACTGGCAGCGGATGCAGCAGTACTTTGCGATGATGCAGCAGCAACAGGCGATGA
GCCGCAACATGGGGGGGATGATGAACATGGGGGGCAACATGGGAGGGATGGGCGGGATGGGAGGAATGGGAGGAATGGGA
GGGATGGGTGGAATGGGGATAAACCCGCAGATGATGCAGATGCTGCAGATGCAACAGATGCAGCAGATGCAGCAGATGGG
ACGAGGCGGAGGTGGTGGCGGGCCGGGTGGCGGAGTTGGAGGGCCTGGAATGAGTCCGGCGATGATGCAGCAGATGCAAC
AACAGCAACAGCAGCAACAACAACAGACAGCAGCCAATCAGCAACAGGCGGGCCAGGGAACGCAACAGCAGCAGCAGCAA
CAGCAACAGCAGCAGCAGGCGGGACAGCAACAGGCGGGCCAGCTCAACTTGCAGCAGCTGCCGATGGGTGGTGGCGGTGG
TGGAGGTCCAGGATCGGTTGGCAGCAATGGCAACGGCAGTGGCAGCGGCAATGGCAGCGGCAATGGTGGTCCCGGCGGTC
CTGGAGGAGGCTATGGCGGTGCGCCGACGTCGTGGGAGGGCATGTACGACGACGTGCCGCAGCCAGGCATGGGTCCGGGT
GGACGTGGCGGCGGTGGTGGTGGTCCCGGATTCCATCGGAACCGGTCGCAGGACCCGATGAATGCGCCGCCGGCCAACGC
GCCGACAGGCCCGAAGAATGCCGGACGGCCGGGGGCTAACTACCGGGGCGGCGGACGGGGTGGCGCTAGCAACCGTGGCT
TCCACCCGTATTCACGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62