GenePrediction:GLEAN_4752 Details

Name: GLEAN_4752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:602013..597333 (- strand)
Length: 4681
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:602013..601639 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_167:601459..597691 (- strand)
Length: 3769
Type: CDS
Source: GLEAN
Position: GCSC_167:597631..597333 (- strand)
Length: 299
>GLEAN_4752 class=GenePrediction position=GCSC_167:602013..597333 (- strand)
ATGCCTCCGAAAAAGGGCAAAGACAAGGCGGCAGCGGCGGCAGCAGTGGCAGCGGCAGCAGCAGCAGCAGCAACCAAGCC
GCCGTCCAAGTCGTCGTCGGGAAAGAAGAAGAGCGGCGCCGTCTCGACGATCGGGTCGACGGCGCCGGCTGACAGCGACT
TTATCGTCTTCACCAACTCGAACAAGGAGAGCAGGCCGAAGCCGGTCAGCAAGATCGTCGTCGCCGGAGGACCAGAGACG
GCGGCAGCTGATGGTCCTCCCAAGCCGACGGTCAAGCAGATCATCGGGGGCGCGTCCTGGACCGGAAAACTGCCGGTCAA
CATGTTGTCGGAACACTGCCAGAAGCAGAAGTGGGACAAGCCGGACTACGACGTGGTGAGTGATGTGATGATGTGGTGAT
GGGGCTTACTTTTCTGCTCCTTCCTATTCTATCTCTTTCTTTTGTTCCTTTGTTCCTTCCTCTCTATACTCGTTCTTTCC
TACTCTCTCTCCCCTCTCTCTCTCCCCTTTCTCTCCTCCCTTCGATTCCTTCTCTTCCCCTCTAACTCAATCAGCGAAAA
GTCAAGGATGGCTTCTCTGCCTTCGTCTCTCTCAGCGCACGCAACAACAAGACGGGCGAGGTGACACGGTTGGAGCCGTT
CAAGCTACCGCCCAGCCATGTACACCTGGCCATCCAGCCGACAGCACTGGAGGCTCGACACTTTGCAGCCACCTACGGGC
TCTTCCGGGTATGCAGCATGAAGAACATGCACATGACGCTGCCACCGGCATACAAGAGCCTGTGGCGCGAGTTTGGCACG
CTCAAGACACAGGACGTGCGTGACGGCCGGGCGTGGATGTACGAGGCCGACCCGTTTCTGGCACTCCGGGAGCGCGAGCT
AGCCAAGCAAACGGCCGAGAAGAAGCGACAGGAGCAGCAGGCAGCACGAGAAAAGGCAGCGAGCCGGGACGGGCTCGAAG
GAACGGGAGGACTGCGAGCGGGAGGTGGCAGCACCGTATCAGGAGGTACAGGACGGGGCGAATCGCGGGCCTGGTCGAAC
AACGTGCCGCGGATCGAGATGGGCAGCAAGACGCGGACGAATCTGGAGGATCTGCTGCGACGCGGCTCCATATGGAATCC
ACAAGGGGTAGTGCTGACAGCAGCGGTACAGCGCGGCATCGTAGAGGAGCTGGTGAAGCTAGGGTTCCGGCCGAGCCACG
TGGAGGAGGCGGTGGCGCTGTGCCAGGACCGAACGGAGACGCTGGAGTGGCTGTTGGTGCACGTGCCGGAGGACGACCTG
CCACGATGGGCGCTGCCGGAGAGCTACACGGCGGGCGTGTCGGTGGCAGCGACAGATCTGCGGCGCGAAGCGGCCATCGT
GCGGCTGGCACAATCGGGCTATGCGGTGGACCTGTGTCGGAAGCTACTAGACGCCAGCGACGGCGACGAGGGCCGGGCAG
CCGCACGGCTGCAGGCGGTGCTGGTGGGGGGCAGCCCGGAAGTCGAGGCTGAGGTCGAGACAAACGGGCCATCCTCATAC
GACTCTGCAGACGAGTGCTGGGAGGCCGAGCTGGCCAGCCTAGAGTCGGTATTCGGGGCCGAGCAGTTCCGACGTGTGTC
AGAGGCCGTGTGCGAGATCCAGCTGAGCGGCGTGGTCAACGTGGTCCAGGGCGAAGCACGGCCGGTGGCAGTGGGCTTGC
AGTTCCGGCGAGCAGCAGGCTACCCGGCCGAGCTTCTGGTGGCAGTGGTGGCACCACAGCTGCCGGCATACATCCGACTG
AGCATCGTGCGGCAGGTGCTGGCACAGGCGAATGTGGGACTGCGCGGCGAGGAGATGAAGATGTACTTTGTGGCAGACTG
GGCACAGCAGCACATCAACGCCATCATCGAGCGGCCCGGACGGCTGAGCGACATTGCGGCGGCGGCATCGACAGCATCGG
AGGCGACGGGCGACGGCAACCGGACGTCGTCGCTGGCAGCAGAAGCAGCACCGCGCAAGCGGACACCCCGACACCCGAGG
GCAATCGCGTGGGCAGCCGACGAGAACTCGCGCCAGGACTGGCTTCGGCGACAGGAGGCACCGGGCTACCAAAAGATGCT
GGCGCAGCGACGGCGACTACCGGCCTGGGAGGCACGCGAGGCAGTAGTAGCAGCCGTGCGGATGCACCAGGTGACGATCA
TTGCAGGTGAGACGGGATCAGGCAAGTCGACGCAGTCACCGCAGTTTCTGCTGGACGACCTCTACAACCGCGGACTCGGC
AGCGCGGCCAACATTGTGGTGACGCAGCCGCGGCGGATCTCGGCACTGGGGCTGGCCGAACGGGTCAGTGAGGAGCGGTG
TTGCAGTGTTGTCGGCGAGGAGGTCGGCTACATCATCCGGGGCGAGAGCCGGGTGTCAGGAGGAGGACGGAGAGGCGGTG
GTGGCAGCGGCGGGGGGCGAACAAACCAGCGAACGGCCCGCATCACATTTGTCACGACCGGTGTCCTGCTGCGACGACTA
CAGGTGTCGGGCGGCCGGCCAGAGGACGTGGTGGCAGCGCTGGCCGACGTCAGCCACGTGGTGATCGACGAGGTACACGA
GCGCAGCCTAGACACGGACTTTCTGCTAAGCATCCTACGCGACGTCTTACGGCAGCGGGCAGACCTGCGGCTGGTTCTGA
TGAGCGCGACGCTGGACGCGGCCACGTTCCGCGACTACTTTGCGCGCGATGGGCTCTCGGTGGCCTCGGTCGAGATTGCC
GGCCGGACGTTTCCGGTCGAGGACCTTTACCTGGATGACGTCATCCGGGCGACGGGCTTTGGTCTGGACGGAGCTGGGAG
GAGAGGAGGTGGAGGCGGCGACAATGAGGCTGACCCGGTGGCCAAGGCGATCCAGCAGCTGGGCAGCCGGATCAACTACG
GGCTGGTGGCCGACACGGTGCGAGCGATCGACGAAGAGCTGACGCGGACGAACGATGCCGGTGCCGTTCTCGTCTTTCTG
CCGGGCGTGGCTGAGATCAACCAGGTCTGCGGGATGTTGGGAGGAGGTCGTGGTGGTGATGGTGGTGATGGTGACCGAAA
AGACTCTCTCTACATTCTCCCCCTGCATGCCGGTCTGGAGACGCGCGAGCAGAAGCGGGTGTTTGCGGCCGCACCGACAG
GACGGCGAAAAGTGGTGGTGGCGACCAACGTGGCCGAGACATCGATCACGATCGACGACGTCGTCGCAGTCGTGGACACG
GGCCGGGTCAAGGAGACCAGCCTGGACGTACAGACAGGCATGCGACGGCTGGCCGAGACATGGGTATCGCTGGCAGCGGC
CAAGCAGCGACGCGGACGAGCCGGAAGAGTGCGGCCGGGCCACTGCTACAAGCTCTACACGCGCGCCCTCGAGAGCCAGC
AGATGCCACCACGACCAGAACCCGAGATTCGCCGTGTTCCGCTCGAACAGCTGTGTCTGGCCGTACGAGCCATGGGCATT
GCTGACGTGGCCGGTTTTCTAGCCCGGGCTCCATCACCGCCAGATGTTGCCGCCGTGGACGGAGCTTTGCTGCTTCTTCG
GCGGATGGGAATCCTGGGAGGAAACACGGCCTCCAACACGCTCACCTCGCTCGGAAAGCTCGTTGCTGCCATCCCTGCCG
ACCTGCGCTGTGCCAAGCTGATGGTCTACGGCGCCCTCTTCGGCTGTCTGCACCCATGTGTGACCATGGCGGCCATTTTG
AGCAGCGGCCGTGCCGGCGGTCCGTTTGTGTCGGTGCCGCCCGATCGACGCCAGGAAGCCAAGGCTGCCCGCATGCGCTT
TGCCGCGCCCGGAACAGCGGCCGACGGCGACCTCTTGACGGACCTGCGCGCCGTCTTGCGCTGGGACGACGTGGTGGCCG
AGAACCAGAACCGTGGCGGTGGCTATCGGTATGGAAACAGCGCCTACTCTTCTTCGCGCCAGGTCCGCGCCTTTTGCGAC
GACAACTTTCTCTCCCAACAGGCCCTCGCCGACATTTCCACCACGCGGCAGCAGCTCTACGACGCCATGGCCGACATGGG
CATCCGGCCTGAGAAGACGTCGTCGGCTTCGTCAGCTTCGTCCATCAGCTTTCCTCTCTTGCGCGCCCTCACCGCCGCTG
CCTTCAACCCACAGATCGCCCGGATCCAGCTGCCCGACCAGAAGTTTGCGGCCAGCGTGTCCGGCACCGTCGCCCTCGAC
CCAGAGGCTCGCACCATCCGCTACTTTGCCCGTGATCATGGCCGCGTCTTTATCCACCCGAGCAGCACCCTGTTTGACAG
CCACGGTTTCGGCGGCCGCGCCGTCTTTCTATCCTACTTTACCAGCATGGCGACAAGCAAGGTGTTTATCCGGGATCTGA
CACGTGAGTTTTTTCCTTCTCCTTTTATCTTTTTCTTCTCTCTTCTCCCGCTAACCTTCCAGCCTTCAACGCTTACACCC
TCCTCATGTTCGCCGGCGACATCGACCTCGACACCCTCGGCCGCGGCCTCATCGTCGACGGCTGGCTGCGTCTCCGAGGT
TGGGCCCGCATCGGCGTCCTCGTCTCTCGTCTGCGCGGCATGGTCGACCGTCTGATTGCCCGCCGGCTCGGCCAGGGCGA
CAGCGACGACGACCCCGACCGCGATGTTCCCCCCGACAGCACCGCCGACACCGAACAGATCGACCGCGATATCCTCAAGG
CCGTCGTCAGACTGATCGAGCTGGACGGCCTGGACTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62