GenePrediction:GLEAN_4753 Details

Name: GLEAN_4753
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:593932..591656 (- strand)
Length: 2277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:593932..593833 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_167:593772..593633 (- strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:593566..591656 (- strand)
Length: 1911
>GLEAN_4753 class=GenePrediction position=GCSC_167:593932..591656 (- strand)
ATGTCCGATATCCTAAACAGAAACACCGGCCTTGGCGTCTTTGTCAATGTAATGGGTCTTGTCAAAGACTGTCGGCTTCC
AATGACCATCAAACCCGGCCGTACGTCGTTTCTAATATCAGCTTTGATACTTTTGGCTGACTTTTGTCTGCCCTCTCTAG
AAGTCAAGACAACTTTGAAACTATACGATATATCTTTGCAAGACGATTACGCCACTCTTGCTCTACACGTATTCGGTAAA
AATCGAGAGGAGATGCCTGTAGTCAGTGCCGCTGACGTCGTGCTGATTCGACAGGCAAAGGTGGGCTCCCTTTTTCCTCC
CGCTGCCATGCATGGTCACTAATGCTCGGTGCTCTTACTTGTGCAGGTGCAAGATTATGGGGGGGTGAGATCAATTGTGA
CCAATTTCTCGACTACCATTTGCGTATATGCGGCCACCAAAATCCCTCTAGAACCAGAACTGCCGACTTCTGCTCGAAGA
CCACCGACATGGAATCCAACTCAGAGCAAAAAACCGTCCACGCCGGAAGAAAGCAAATACGTCTCATGGCTCTTCCACCA
CATTCAAAAAACTGTCATTTTGGAGCCAGTCGAGTTTGCTATAGAGGCGGCAAAGACATTGAACATCGCAGACAAATTCA
GCACCCTGAAGGACGTGACGGATGGCAAGTTTTACAATCTCATCGCCAGGGTTGCGCACAAGCCATTGCCCATCCACGAT
TATGTAACACTGTGGATTACGGACTACACCGAGAATACCCGCTTCCAGGACTTCGACGTGCCCGACGGCAAGCCTGGACA
GAGCACACAGGTGGGCGATGCACATGGCTACCTGAACAATTCCACCGCCAATGTCAGCAGCAAACTGTTGTCGGATTGGA
CTGGCCCACGGGGGAAAATGAGCATGCAGGTGACCTGCTATGAGCCCCATGCAAGTTACATCCGAGATTACGTGACTGCA
AGCAATTGGGTAGAGTTGGGAAATGTTCAGGTCAAGATGGGTCGCAATGGAGCCTACCTCGAAGGCTTTATGCGGGATGA
CCACGCTTACGGAAGTCCGATCCGGGTCAGCTGTATCGAGGTGAATCCGGGGGACAGAGATTCGATCGACCCGCGACACA
AAGCCGCTTTGCGACGGTATCGAGACTACAAGGTCCAATGCAAGGTTATGTCCCAGAAGAAGCGGAAAGCCGACGGCGAG
CCAGCGCAAAACAAGAAACAGAACAGGGCCAAGGAGCAGCGGGGGCTGCTGCGGTCCAAGCAGTTTGGCACAAATGCCCC
CGGCGACGACGGGAACGGACAGCTGCCCGAGGGGATGATGGCACCAAACCTTAACAGTAGCATCGTGTCTGAGAACCAAC
ACCGGGCGATCACGAGACTGGCGGATGCGCTCGAGCCTTTCTGTTGCCAGACAGACACGGCTGACCAAAAGGCAGCAGGA
CTGTTGCCGCTGCCGTTTGTAAACGTCAAGTTCCGCGCGCAGGTGCGTGTTGTCGACTTTCGGCCGTCACGTCTGGAGAG
CTTTGCCGTCGGCCGACGACCCCATGTGCTAGACATCCTGTCGGACTACGAGCGCGATACGGATACCGGTGACAGCAACG
AGGACAGAGCGACCCAGCCGGGAGCGAGTGGCCGTGCGCGTGTCCCGCTGGTCTGGGAGTGGCGGTTTGCCCTACTGCTC
GAGGATGCGACGCCGTCCGCGACGCCGTCCGCGACGCCGCCCGCGCGCATCTGGACCGTCGTCGACAATGCCGGGGCACA
GATGCTGACGGGCCTGAACGCGTGCGACCTGCGCTGCAACGTCGACGCACTGGACGCCCTGCGCGAGAAGATGTTTGTGC
TGTGGGGCGATCTGGAGGAGAAGAAGCGGCTGCAGCTGCGCGCCAAGCGAGAGGCCGAGGTGGCCGCGGCTGCCCAGCGG
CAGAAGGGAGAGCAGAAGAAGCGGGAAGAGCAGAAGAAGAAGCAGCAGCAGCAGAAGCAGAGAGCGCAGAATGCAAAGCC
CGGACAGACATTTCTGCCACCACAAGACTCATCCGACGACGAGTGGCACGACAGCCAAAAGGGCCGGCAGAAGCCCGACA
CAGCACAACAGCCTCAAACAGAACTGCCTTCACGGCCTGTGGAGGATGATGACATTTCCAAGACGGTCAGCAATCGGCCG
TTTGTCTGCTGTGTGTGGCAGTATGGAGCCAAAGATGCAGGCGACGAGAACAGCAACGGCAAGCGCACGTGGAAACGCAT
GTTTGCGCTGTTTGGGACAAAGATAAGCGGTTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62