GenePrediction:GLEAN_4754 Details

Name: GLEAN_4754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:571159..566747 (- strand)
Length: 4413
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:571159..571096 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_167:570033..569485 (- strand)
Length: 549
Type: CDS
Source: GLEAN
Position: GCSC_167:569302..568278 (- strand)
Length: 1025
Type: CDS
Source: GLEAN
Position: GCSC_167:568219..566747 (- strand)
Length: 1473
>GLEAN_4754 class=GenePrediction position=GCSC_167:571159..566747 (- strand)
ATGCAGGCTGCTCTGCCAGACACAGGCGATGGGGCCCGGACAATGCGCCAGCACGGATGGCAGCGTGAGAGGGTGCTCGC
GTACTCTGTACTATTCCCCATAGGCACCACCGCATCTCCACATGGACCACGGAAGAGGTCCCCAGCACGCTCTCGCCTGC
CGATGCCGCGACGGCCATTCCAGCCTCCGGCAACGAAGCAGAAGCGACAGCATCATCAGCAACAGCATCAGCAACAGCAT
CAGCAACAGCATCAGCAACTGCGACAGCAGGCCGGCGGCCATGACAAAGAGCCCCCTCGGCTCGCGAGACTAGCGATGCT
GGTTGCGCCAGGTCGACGCCGCCGCGTCTCCCCTAGCGACCCCGTTTGGGCCTGGCTCGCCAGAGCCACCGGCATCCATC
CCTCTTGTCGTAACGCAGTCGCCCATGCGCCTTGCGCCATTGGTCACCCACCCTCCCGCCAGCTCAGCCCCGCTCGCTAC
GGAGCAGGACTGTGCATCCAGGCGGTGGTGAGGAAGCGGATGGCCGAAAGAGCAGAGAGCAGAGGCCAAGGCAGCTGTTG
GCCGACTGGGCGCTTCCGCTCTCGCAGGCAGGCTGGAGTGAACGGCGTCCGGCGCTACCATGTAAGATACGATGTTCGCC
AGCGATGGATCTGCGCCGGCTCGCCAAGAATGGCCCGTTTCTCTACATTGTATCTTACATGACCATCGATCTTCGACCTT
GCGCGGCCCTGCTGATGCGCTCCCGCGCTCGACGCCCCATCCTCTACGGCTGCGTTCGCACACAGCGGCGCGGTGCTCCC
GATGATGTGCTGTGCCAGAAAGAAAGAACGGAAGAAAGGAAAAGAAGTAAAATCCGCTGGCCATCGGTGTGCAGGAGACT
GACCAACCCCTAAAGTGCCTGAGCGCCAGCACTGTCCTCAGCAGGCAGGGCCCTGGACGAGGTGCCTCGAACGCCCTGTA
GTGCCCTGTAGCACCCCGTAACCTGTACTGGCTGGACTGGCCGGCTCCACCTAAAGGCGAAGGAGCGAAAAAATACCCAC
CTTCCAGGCCAAGTCAAACCCTTCTCTCTTTTCCACTCTCTCCAGGATTCCTCGCCAACACCCACCCTCGACCATCGGGC
ACGCAGCGACAACCAATCTCTCTGGTAAGACGGTCGTGCCTCTCGCCCTGTCTGCCGGCCTTTCTGGCATCTCGCCTGCC
ATCTTCTGCCATCCGCCTGCTCTGCCCGTGCTGATTTCCCGCCCGCAGGTGCAGGCATTTTCTTCTGGTGCATTCTGGCC
AGAGATCTCCCGTCAAAAAGCCATCGACCTCGGAGTCGCCGCCGTCAACACTGCCAATACCGTCCCCTGCTGCGTCTGGT
ATGTTTCTCCGGCCCTCTCCCTGCACGCGATCATGGCTGCATGCTTTTTCCCGTCTTTCTCGCCGTCCCGGCCTGGATCG
GTGCCGTCGTTGGCTGCGGCTCTCCGCCCAAGTTATGGCCCACTGCCTCCCAAAACTGCCCGTGGGCTCCCTGTCACCGC
CGTCTTCTCCCCCCTTCCCGACTCGCACCTCGCCCTGGCCGAGTCCTCTTGCTCGCACCTGCTCTGGCTTCTTCGTGTTT
TGCTGACGTCGCTGCCATTCTGCAGAACCTGCCAGACATCGGTCTCTGCGCTCCCGATCTGCGCCGGCCTAATCCGTCAG
TCTGCCTCTGCAGAGGAACCGCCCACACATCAGAAGACGAACAGACTCAAACACATACACCTTCCCTCTTCCACATCCAC
TCACACACACGCACCCACACACGTAACTTCCCTCAAGAAAGAAGACACGGGGAAGACCAGAAAAAATAACAGTCATTTGT
TGCGCTGTATCCGGAAGAAGCCAGAGCGGAAAAGAGAGAAACAGAACACGAGACTCAGGAGAGGCGGGCACTGAGAGTGG
TCGCTGCTGCTGCCGCTGCTGCTTGCTGGCTGGGCCACTGTGTCGGCCCCAACCGCTGCTCATCTTCATCGCCGCTGCCA
TTTCGACCCAAACCGGCCCATTCACCTTTCCCATCTCCCCATCTTTCCCATTGTCCGTCGGCCGCTCGTGCGATGGAATA
CAACCATACTGCCCACAGCCCTGGGACCCCTGCAGCCATGTCGGCCACAGGCGCCACCCCACGGCCGTCTGATCCCAAGA
CGGTCCGCTTCCAGCTCATCACGCCCGACTCACCGCACACTACCGCCCGTCTGCCAATGCGCGTGCAAATCTACCCCCAC
GATGCCACAGACTCCATCGTCACCACGGTCAAGAACTTCTACGGGCTCTACTCGAGCCCGACCAGCTCCAAGGGCGTCAG
CTTTGAGGACGAGGCCGGCAACACCATGATTGCTCGCTACGAGAACTTCCGCGACAACATGGTCGTCTACGTCCGCGTCA
TTGAGGAGCCGGCGCTCTCGCCCAGTGCTTTTGCCACCCGCAGCTACCGTTCGCCGCCTGCTGTGGCCGCTGGCGAGCAC
TACGACGAGCAGGCCCGTGATCTGGATGCTCCTTACCACCCGTCCTATGCTCCCCTGCATCACCACCACCACCTCCACCA
CCACCACAACGACGACTTCATCTCGCGCCCCGGCTCCCGCACTTCGCGCAAGCGTAGCCTGTCGCCCAACAGCGCTCGCG
GCCGTCGGAGCGACTCGGCCAGCACCAATTCCAAGAACCGGTCGCGCTCTTCCAAGAACCGCGGCATCGCCGGCAACGAT
GCGTACGGTGGCGACAGCCTGAACGGCTACACTAGCGGTGATGGTGCGCCTGGCTCTGCCACCGGCCGTATCAAGGAGCA
GCAGCCCATTGGCAACACCGAGATCAGCGTCGAGAACATTGTCGAAGGCGGCCGCCGCAAGAGGGCCAAGTTTGAGAGCT
CAGTATGTGTTTTGCGTCTCTCCATGTCTCAGCTGTCTCAGCTAACTCCCCACTCTGCAGGAACTGCCCTTGTTTGCTCC
GCCCCAGATGCCTGCTGCGACTTCCAACCCATCTGTCTCGCCTGCCCGCCGTTCGGACCACCGGCCGTCGCTCCCCTTTG
TCTACCCCGGCCAGAACCCGTTTGCCGGTGCCGGTGCCCTGCACTCGCCGCAGAGCCATCACACACACTTTGGACAGAGC
GGCATATATGCTACTCCCGGCTCGGACGGCCGCCGCACGCGTGCCAGCATCGGCTATTCGAGTGTCGGTGCCGGCATGGG
CGTCCTTCCCACTCCCGATCCGACGGTCAGCTCCGTGTCGGAAGAAGACAAGGATGTGGCCATGCAGCTCATGCGCCTGG
GCGAGATGTCCAACTTCTCGTACGGCCGTACGTCGACCTCGACGCAAGACGACACCTTCAGCGGCAGAGCAGATGCGGCG
TCGTCCACGGGCGCCACGAGCGACTCGGACAGCGACTGTGACTGCGACAGCAGCCTTGGTGGCGGTGATTCGGACGATGC
GCAGGTCAAGCGCAAGCTGAAGCCGGACGTGGACGGCATGAGCCGGAAGATCTACCAGTCGGTGGAGAGCGGCTACGGTG
GCGACATTGACGTGGACGAGAAGATCAAGTCGCCCGTGCCGACGCCGGTCTCGGTGCCAGTGCCGGGACTGATGGCCGCA
CCCAAGCTCAAGAAGACCACAGCCAAGACAGCATCAGCCTCCAGCGGTGGCGCCGTGAAGCCGCCACGGGCACAGACGGC
GAAGCCGAAACCAAAGACGGCCAAGGCCAAGGCCGCCGGGAGTTCTGCGGCACAGAACGGGAGCAAGGCGAAAAAGACGA
ACGCCATTGCCCCGGGCGTGCCAATGTCGCCGGCATCGATGCCAGCGTCACGGAAGCTGTCGGTTGCGTCCAACGGCGGT
GGCGTCCCGATTGCGGCAGCGACGGCTGCCAGCAGCGGTGGTGCCGGGGACGAGGATATTGCGGACCTGTCAAGCAAGCC
ACGCTGTCAGCGATGCCGCAAGAGCAAGAAGGGCTGTGATCGCCAGCGGCCCTGTGGTCGGTGCCGGGATGCCGGGATCC
CAGCAGAGCTCTGCATCAGTGAAGACGAGGGTAACGGACGCAAGGGCCGCTATGGCCGGCACATGGGCGTGCCCATTAAG
AAGGACACTGCTGCTGGCGCTGACTCTCCCATGCAGCCGCCGCCGCTGCCGCTGCCGTCTGCCGCTGTTGCTGCTGCCGC
TGCTGCAATCTCGGCTTCGGCCGTGTCGGCAGCCGTCTCTCCGGCTCAGTTGCCCCAATCGGTCTCGCATCCGGCATACC
AGCTGCCCCCGATCAGCTCGCTGGGCCAGCTGGGCCAGCAGCAGCCGCTACTGCAGAAGTCGCTGTCCTCTCTTCTTCCG
CCGGCCCCGATCTCGGCCACACCCATCCTGGCTCCGACCATTCCCGCCATGGCCATGGCGAGCGCCGACAAGAACAAGAA
GCGGAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62