GenePrediction:GLEAN_4757 Details

Name: GLEAN_4757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:552280..549343 (- strand)
Length: 2938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:552280..551971 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_167:551910..549868 (- strand)
Length: 2043
Type: CDS
Source: GLEAN
Position: GCSC_167:549791..549343 (- strand)
Length: 449
>GLEAN_4757 class=GenePrediction position=GCSC_167:552280..549343 (- strand)
ATGAGTGCAAGACGTATTGCGTCCGGGGCCCTGGGGCCTCTGGTACGCCGCAGGGCCGCCCAGATGGTCGTCCGTTCTTT
TCACCAACGGCTGCTACCCGTCGGAGGATTACAAAGGACAGACATATCTATCCAAGCGGCACGGAAGCACATGCGATTCC
CAATCAACGGATACCACAACGCGGTGATCTCGCGAAATGCCTCATTTGCTCGCCTCATTCCTAAGCTCGTCATCAAGTTT
GCCCGGGTTCCGGCCATGTTTGGTGGTTTGCTGATAGGAGGCGCAGCTTGGGTTCAGTACCAGGCCATTCGTAGGTGACC
AGACGTTTCGGTCGGAGGCGGGAGAGGCGATTGCTAACGCTGGCACGCAGAGGTGGGAAACTCGGCCTACGACATGTACA
GGACCACCCGGGACGGGTTGACAGAGACGGCAACAACATTCTGGGACGGGGCGCTCAACATTGCGAATCAGACAAAGCAG
GGATGGGAGAGCACGAAAGAGCATATGGAGATGCCTGAATGGATGCAAAAAGTGCTGAAGCTGCACGAGAAGATCGGAAC
GGGCAGCGAGGGTCCTAATGGCAGCGGTAAGGGCCCGAAGGAGAGCAGAGGTGCTGGAGCAGCCGGAGCAGCAGCCGGAG
CAGCAGCTTACGGATACTCGGATGGCGGGGACGACGACGAGCCGCGGGCGGGAACAGAGAGCGGTGCGCGGGACGATCAG
ATGATGCTGTTCATTAAGAAGATGATTGAGATCCGCAACATCCTGCAAAAGGTGGGCCAGTCAAGCACGCTGACGCTGCC
GTCGATCGTGGTGATTGGCTCGCAGTCGTCGGGCAAGAGCTCGGTGCTGGAGGCGATTGTGGGGCACGAGTTCCTGCCCA
AGGGCTCGAACATGGTGACACGGCGGCCGATCGAACTGACGCTGGTCAACACGCCCGACTCGAAGGTGGAGTACGGCGAG
TTCCCGGACCTGGGGCTGCGGAAGATCACGGACTTCTCGTCTATCCAGCGAACGCTGACGGAGCTGAACCTGGCCGTGCC
GGACTCGGAGTGCGTGTCGGACGACCCGATCCACCTGACGGTGTACTCGCCACATGTGCCGGACCTGTCGCTGATCGACC
TGCCGGGATACATTCAGGTGGTGGGCCAGAACCAGCCGCTGGAGCTGAAGCAGAAGATCTCGGAGCTGTGCGACAAGTAT
ATTCAGCCGCCCAACGTGATCTTGGCCATCTCGGCCGCAGACGTGGACCTGGCCAACTCGACGGCGCTGCGGGCGAGCCG
GCGGGTGGACCCTCGCGGTGAGCGGACGATCGGGGTGGTGACGAAGATGGATCTCGTGGACGCGGAGCGTGGAGCGTCGA
TCCTGCTGGACAAGCAGTACCCGCTGCGGCTGGGGTACGTGGGCGTGGTGGCGCGGGCCCCGACCTCGGTCGGCGGTGGG
CTGTTCAAGAAGGGCGGCAGCGGCAATAGCCTGATGCGGCAGATCTCGAAGAACGAGGAGGCCTTCTTCAAGGCGCACCC
GCTGGAGTTCGGGGTGGGGACGGAACTGGCGCTGGGAACGAAAACGCTGCGGCGGAAGCTGATGCACGTGCTGGAGCAGA
CGATGTCGGCGAGCTTGCAGAGCACGACAGACGTGATCCGACAGGAGCTGGAAGAAGCCACGTACGAGTTCAAGGTGCAG
TACAACGACCGGCCGCTGTCGGCGGAGTCGTACCTGGCCGAGAGCCTGGATGCGTTCAAGCACTCGTTCAAGCAGTTTGC
GGAAGAATTTGGGCGGCCGCAGATGCACGAGCTGCTCAAGGGCGAGCTGGACCAGCGGGTGCTGGATCTGCTGGCACAGC
GGTACTGGAACAAGCCGATCGCGGACCTGCTGCCGGCGGTAGTGGAACTGGATCCGCTGTCGGAGCTGCCGAGGGCCGAC
CCGGACTCGCTGTACTGGCACCGGCAGCTAGACGCGTCGACGTCGCAGCTGACGAAGCTGGGGATCGGGCGGCTGGCGAC
GAATGTGGTGGCGACGAGCATTCAGGCCCACATCGAGCGGTTGATCGCGCAGTCCAACTTTGCGAGCCATCCATTTGCGC
GGCAGGCGATTGTGGACGCGGCCGCGAGCATTCTCAACGACCGGTTCTACAGCACGAGCGACCAAGTGGAAAACTGCATC
AAGCCGTACAAGTTTGAGATTGAGCTGGAATCCCGCGAATGGGAAGGCGGCCGGGAACACGCGGCCGTGGTGCTCAAGAC
GGAGCTGCACGCCTGCCAGGACGCGATGAAGCGACTCGAGGGCACTGTCGGTGGTCGTCGCAAGCTGGGCGAGGTCATGG
GATTCGTGGACCGGGCGAGACGCGGCGACGTGGTGGTGGAGGGTGAGGGCCGGAGTGGTGCCGGTGGCTACAGTGCAGCT
CTTTTGCAAAAGGGTGAGTTTTGGGTGTTTTGGGTGTTTCGGGCTTTCTCCTTTCTTCTTTTCCCCCATTGTGCTAATCC
CCTTGGCAGGACGTGAAGCGGTCTTCCTCCGTGACCGGGCCGACATCATCAACATGCGGCTGCTGGCAGCCAAGTCGAAG
CAATGCCGCAGCATCAGCAACAAATACTACTGCCCCGAAGTGTTTCTGGATGCGGTGGCGACAAAGCTGGCCAGCACGGC
AGTGCTCTTCCTCAACGTGGAGCTGTTGTCGGAGTTCTACTACAACTTCCCGCGCGAGCTGGACCAGCGGCTAGGCCGTC
ACCTGAGCGACGAGGAGATGGAGCGCTTTGCCAAGGAAGACCCCAAGATCGGCCGCCACTTGGATGTGATTCGACGCAAG
GAGCTGCTGGAGCTGGTGCTCGACAAGATGGAAAGCCTGCGCCAGCTAGAGGGCCGCGAGAAGGGCCGGCGCATCGGTGG
CAGCAGCAGCAGCAGCAGCGACAAGAAAAAGGGCGGCAGTCGCTGGGGGCTGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62