GenePrediction:GLEAN_4758 Details

Name: GLEAN_4758
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:548650..545492 (- strand)
Length: 3159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:548650..548516 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:548451..548413 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_167:548341..548261 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:548195..547914 (- strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_167:547856..547785 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_167:547726..547613 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_167:547549..547528 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_167:547472..547432 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_167:547366..546920 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_167:546859..546663 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_167:546438..546416 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_167:546363..546317 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_167:546255..546225 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_167:546162..546010 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:545957..545919 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_167:545853..545697 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_167:545636..545492 (- strand)
Length: 145
>GLEAN_4758 class=GenePrediction position=GCSC_167:548650..545492 (- strand)
ATGCAACTCGTAACCCTAAGCTGCTGTAACCTCAACCAGTGGGCACTGGACTTTGAGGGGAACACGAAGCGCATCATCGA
GAGCATTCATGAGGCCAAAAAACAGGGCGCAAAGCTGCGTGTCGGCCCCGAACTGGTGTGGTCTTCCCTTTAGCCGATGC
GCGATGACGCACATCAACTGACCGTGACCTCTCTCTCAGGAAATATGTGGTTACGACTGCTTGGACCACTTCCTCGAGGT
AAGTCTCTTCCGGGCATAAATTTTCCTGTAGGACAACGAGAGCATATTCTGACTCATCATGTCCACCAGGGTGATCTGTA
TCTGCACTGCTGGCAGCAGATGTACCGCATCCTCACGGACAAGTCGTGCTATGACATCCTTCTAGATATTGTGAGCTCTG
TCCAAGGCGATTTCCTATCCGCTGTTATCTGTCGGCGTCTCACACGATAAACTAGGGCATGCCGGTGATGCACCGTGGCA
ACCGTTTCAACTGTCGTGTGCTCGCTTGCAACGGAAAGATCATCCTGATCCGGCCGAAGCTGTTCCTCGCTTCCGACGGA
AACTACCGGGAGAACAGGTACTTTATTGCCTGGCATGGTCCGCGCCATGTGGAGGAGTATTATCTTCCACCCATGATGCA
GGAGCTTCAAGGTTCTATCAAGATACCTATCGGCGATGCTCTCATCAGCACGCCTGATACGTGCCTTGGAGCCGAAACCT
GCGAGGAGCTCTTCACAGTGAGGCAACCCTGATCCCGCCGTTCGAGTACCAAACTAACGCGTCCTTCCATAAAGCCAAAC
TCGCCTCATATCGGCATGGGCCTGTCAGGCGCAGAGATCTTCACCAATAGCTCTGGCTCTCACCACGTATGTATATGAAG
CACCGGTCCTGGCGAAGGCTGCACGCTGATGTCTTTCTTTACAGAACTTGAGGAAGCTGGACATCCGCATTGCCCTCATC
ACCGAGGCCACACGTAAAAATGGCGGCATCTACTTGTATTCCAACAGCCGTGGCGCTGGTGGAGAAAGACTCTACTATGT
GAGTTTGGGGATTTTGACCTCTATCAATCTGAAGTAACGGTTGACTAATCCCTGTTCCTAGGACGGATGCTCTATGATCA
TCGGTAAGTCTTGTCTATGCGTGCGACTCTTGACATTCCTGCTAATGTTCGATTTCAGTGAACGGAAACATTGTCGCCCA
AGGCAGCCAGTTTTCTCTGGTAGGAAATCGCGTATTTATTTTCCCCTTGCAGCCATGGTCGGGCTGACAGTATTCCGTTG
GCAGAAAGACGTGGAGGTGATCACGGCAACAGTTGACCTCGAAGAGGTCCGATCGTTCCGCTTCACCCCGTCTCGAGGTA
TGCAGGCCATGCAGGCGCCGGCTTACCAGCGCATCGAGGCCTCTTTCAGCCTGTCGGACGACACCCTGGGCCTCGCTCCG
ACCAAGACTCGTCCGGCACATTATCACCTTCCCGAGGAGGAGATCGCCCTTGGGCCAGCATGCTATCTTTTCGACTACTT
GCGGCGCTCTGGTGCTGCAGGTTTCCTTCTGCCGCTGAGTGGCGGCATCGACAGCTGCGCCACGGCCACCATCGTCTTCA
GCATGTGTCGGCTTGTCATGGCTGCTGTCGAAGAGGGCAACGAGACGGTGATGGAAGTTTTCAAGCGCTGGTGTCGGCAT
GCCGAGACCCTCCCCAAGACGCCACAGGAGCTGTGCAATTGCATCATGCATGTGAGTCTACCGATGCGTCGCGACAAGTC
CCTGAGACTTATGCTTACACATGGCATCCAGAGCATCTACATGGGAATGAAGACACAGTCTAGCAAGGAAACGAGGCAGC
GAGCCGAGACACTTGCCAAAGACATTGGCAGCTATCACACGGACATCAACATAGACGACGCATTCCATTCATTCAAGGGA
CTCTTTTCTGGTGCGACCGGATTCGATCCGAAGTTCAAGGTTTACGGCGGTGGCAACACGGAGAACCTGTACGTCTGCAT
ACCTGCGTTTATGTTTTCCCCCTCCCCTCTTCGCTTGCTTACATTCTGTAGAGCCCTCCAGAATATCCAGGCACGTTCTA
GAATGGTGCTAGCCTACGAATTCGCACAGCTGTTGCCAACTGTCCGATGGGGCGAAGGTGGTGGAGGCCTGCTTGTGTAT
GTATCTCAGTAACAATCAAGTGATATGCTGATGCTAACCTGTTTTCGTGCAGTCTCGGTTCGGCAAATGTTGATGGTAAG
AAAAACAGGGTTGCCTCTCGTCTGTATCTGTCTAACCGTCTTTTTAGAATGCCTGAGAGGCTACTTAACAAAATATGACT
GCTCGAGCGCGGATGTAAGTTGTACTTTCTCCCATGCGTTGAAGTCTCAGAGTCGTGGTACTGACTGGTTACCAGATCAA
CCCGATTGGGTCCATCTCAAAGACAGGTAGGAACACCGGCTTTGTAAGCATGTGGGACGCCTCAGCATGCTGACACTCCT
CTGGGCAGACCTGAAGCGATTCATCAGGTGGGCTTGGAAGGAGTTTGATCTGGCTATCCTAGAAGAGTTCTTGGACGCCG
TACCTACGGCCGAGCTGGAGCCCATCACCGGCGACTACGTCCAGTCTGATGAGGCCGACATGGGAATGACTTACGATGAG
TGTACGTTGTGCTCGTGCTATACGCCTTGTAGCTCTGCTAACATATGCCTTAGTGTCGACATTTGGAGTTTTGCGCAAGG
AGCTCAAGCTCGGTAAGATGAGCACCTATTTCCTTCCCTGGGATTGTGAGCTGGCCATAGCTAACAAGAAGATCTAGGCC
CTTACTACATGTTCCAGAAACTCGTGCACGACTGGAAAGAGGAACGCGGCCTTACGCCACGGGAGGTGGCCGATAAAGTG
AAGAGATTCACGCACTTCTACTGCATTAATCGCCACAAGATGACCACAATGACGCCTTCAGTCCACATGGAGAGGTAAGT
TTGTATTGTGAAAAAGGCATAGAAGAACGGTCGCTAACGTATTTCTCATCACAGCTACTCACCCGACGACAACCGGTTTG
ATCACCGGCCATTCTTATATCCCCGCATGTGGGACAACTGGGCCTTCAAGATGATTGATGAAGAGGTCGAACGGCTGGAG
GCAGCAGAAGAGGAAGCGGCCGCCAACACCACAATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62