GenePrediction:GLEAN_4760 Details

Name: GLEAN_4760
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:537437..535957 (- strand)
Length: 1481
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:537437..536875 (- strand)
Length: 563
Type: CDS
Source: GLEAN
Position: GCSC_167:536773..536182 (- strand)
Length: 592
Type: CDS
Source: GLEAN
Position: GCSC_167:535986..535957 (- strand)
Length: 30
>GLEAN_4760 class=GenePrediction position=GCSC_167:537437..535957 (- strand)
ATGAGTATCGTCTTCGAAACATCGCGCCAGGCTCCTTACCTTGGCGGAGAAGACAGCTATCCGCCCATCGACCAGGCCGG
CGACGAGGTCGAACGGTACGACGAGGAGGCGGTTGGAAACAATGTCGGTGTTGGCATGAGCGATGTTGGCGATGTAAGCG
AGCTTGCTGCAGCCGTGGCCGGAGGCTACCACGCGCCCGACTCATCCATACTCGAGAGCGAGTCGTCGCGTCTCGTCGTG
GACGAGGTCGTCGGAGCCGGAGAGGATCACGACCATCACCAACACCAAGTCTCCGCGAATATGGCAGCGACAGCTGCAGC
AGCCTCTGCTGCGGCCCAGATGCACGCCAAGTCCAAGGCCTCGGCGCGGAGAGCATCGTATGACTCATCCATATCGCCTC
CACATTCCCTGGGTGAGGCAACATCGTCCATCCATGGATCGCGAATCAAGCCTATTCCCAAGCCCGACCGGGACATCTAC
AGGAATCCAAAAGGAAAGTTCCAGTGCACATGGCCCGACTGTACCGAAGAAGCCCAGGAATTTTCACGCAAATGCGAGTA
CAAGTAAGTCTTTTTTCGCCTCTTCTTGTTTCTCGTTGCCACTCGGTCTTGTCTCTGCGCTTCCATGTCTGCCTGATTTG
TCCACACCGGCTGACTTTTTCTAGTAAGCACATGGATAAGCATGAGCGTCCCTACCGCTGCACAGCCGAGGGGTGTGAGA
AGCTGCCTGGATTTACCTACTCGGGCGGCCTGTTGCGACACGAGCGCGAAGTTCACAACAAGCATGGAGGGCCGCGCAAC
CCGCTTCACTGCCCTCACCCCACCTGCAAGCGCCATGCAGGCAAGGGCTTTTCGCGGCAGGAGAATCTCAACGAACACCT
GCGGCGCGTGCACACGACTACCGGCAGCAGCGTGGTCGGCGTCGACCTGCCTATGGATAGTGGCAATGCGCTGTCTGGCC
TGGCCGATCTGCGGCCCTTGGCAGCTGTTGTGGATGCATCTGGACATGGGGGCAACCCCACCACGTTGTCGGCGGCAGCA
GCGGCAGCAGCAGCAGCAGTCGTGTCGGAAGCCCTTCCGTCCTCTGTCATGCGTGGCGACGAAAACGACGACGACAGGGC
AATGGAGGGCCTGGGACTGCTGACGGGGCATTCGCAAGTCCAGGTGCACCCAAGGAGACGCAAGCGGACGGCGTCTTTTC
TGGGCGATGTCGAGGGCGATCACGGCCACTACGATCTGCGAGAAGAAGTCAAACGGGTGCGCCTAGAGAACGAGGCACTG
CGACGACAGGCAGAGCTTCAGAACGTCCGGATGGCGGAAATGACGACGCAGATCAATCAGCTGCAGCAACAGCAACAGCA
ACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGGCCT
GTAAGACCGAGGCATCGACCCTGACCGACGTGCTGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62