GenePrediction:GLEAN_4762 Details

Name: GLEAN_4762
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:529214..528071 (- strand)
Length: 1144
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:529214..528819 (- strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_167:528742..528071 (- strand)
Length: 672
>GLEAN_4762 class=GenePrediction position=GCSC_167:529214..528071 (- strand)
ATGGCAGCTCTGGTCAATCTCGACGACGACGATGCCCTGGCGCCGACCCTGCAGTCCATCCTCGACCAGCGGTCGCTGCG
CTGGATCTTTGTCGGCGGCAAGGGCGGTGTCGGCAAGACGACCACGTCGTGCTCGCTGGCCATTCAGCTGGCCAAAGTCC
GCCGCAGCGTGCTGCTGATCTCGACGGACCCCGCGCACAACTTGTCGGACGCGTTCTCGCAAAAGTTTGGCAAGGATGCC
CGCCTGATCGATGGCTTCACCAACCTGAGCGCCATGGAGATTGACCCCAGCGCCGGGTTGCAGGACATGATGGCCGGCAT
GTCGGAAGGCGACAACAACGCTGCTGCCGGTGCCAACGGTGGCATGAACAGCATGGTGCAGGAGCTGGCCTTTTCGGTGT
GTTTTTTTTTTCTTTTTCGGATCGTTTCCCTGCAGCGTCCCTCGGGGCTTCATACTAACAATATACTGCTAGATACCTGG
AATCGATGAGGCCATGTCCTTTGCCGAGGTGCTGAAGCAAGTCAAGTCCCTCTCGTACGAGACGATTGTGTTTGACACGG
CGCCGACGGGTCACACGCTGCGTTTCCTCCAGTTCCCATCGGTGCTTGAGAAGGCGCTGACCAAACTGAGCCAGCTGTCG
GAGCAGTACGGCCCGCTGCTCAGCGGGCTTATGGGCGGCGGGGCTGGCGCAACGCTGCCCAACGGCCAGAGTCTGACGGG
CATGATGCAGCAGCTCGAGTCGCTGCGGCAGACGATTAGCGAGGTCAACGCGCAGTTCAAGGATGACGCGCTGACGACGT
TTGTGTGCGTGTGCATCCCCGAGTTCCTGTCGCTGTACGAGACGGAGCGCATGATCCAGGAGCTGGCGTCCTTTAGCATC
GACACGCACAGCATCGTCGTCAACCAGCTGCTATACCCGCGCAAGGGCTCGCAGTGCGAGCAGTGTAACGCGCGCCGGCG
CATGCAGAAGAAGTACCTCGACCAGATCGAGGAGCTCTACGATGACTTCAACGTCGTCAAGATGCCGCTGTTGGTCGAAG
AGGTTCGCGGCAAGGAGAAGCTGGAGAAGTTTAGCGAAATGCTCATCCACCCATACGTTCCGCCAGACGTGTTCGACGGG
TTGGACGAGAAGGCGGCACAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62