GenePrediction:GLEAN_4764 Details

Name: GLEAN_4764
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:495523..494291 (- strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:495523..495478 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_167:495414..495122 (- strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_167:495064..494291 (- strand)
Length: 774
>GLEAN_4764 class=GenePrediction position=GCSC_167:495523..494291 (- strand)
ATGTCGTTTCCCGACAAACCCGTGGCGCAGCTTCTGGGTGCCAACGGTAGGTCGATTGTCCCTCTGTTCTCGTGCTCTGC
CGACAAGGACTGACGGGACGGCGGTGCAGGCCCAGTGCATGCGGTGACGTACTCGGCCGGTGCGGGATCGTACGTCCTGA
CGGGCTCAGCCGACCGCTCTGTGCGGCTGTACAATCCGCAGCCGACGAGCGCGAGTCCGGAGAGCAGCGGCGGCTTTGTG
ACGAAAATGGGCGCGACGCCAGCAGCGGTGACGGCGGTGCCGGCCGGCCGGCTCATCCAGACATATGCCGAGCACGGCTA
CGAGGTGCTGTCGCTGGCGTGCGCGGCTGACAACGCGCGCTTCGTGTCGGCGGGCGGCGATCGCACCGTCTTTCTATGGG
ACGTCAGCACGGCCCAGACGCTGCGACGGTTCAGTGGCCACACCGGTCGCGTCAACTAGCGTTCGTCTTTTGCCGGCGAC
GGCGACAGTCTCGTCGTCACGGCCGGCTTCGACACGGCCGTGCGCATCTGGGACACGCGCGCCAACAACGCCCACCGACC
GGTCCAGACGCTCACAGACGCGCGTGATGCCGTTTCGGCCGTCGCCGTGCGTGGACCCGCCATCCTTGCGGCCAGCGTGG
ACGGTTGTCTGCGCACGTACGACGCCCGGGCTGGCCGCCTCGTCACTGACGTCGTCAGCGGCCGTGCTGGCCTCACCAGC
CTCTGCCTTACGCGCGATGGCCGCTCCGTCCTCGTCGGCGCCCTCGACAGCCGGCTGCGACTCTTTGACCGTGACAGCGG
CTCCTGTCTGCGGACGTACGGCGGCCCTGATTCGACCGGCACCAAAACTCACAACAACACCAGCTGGCGCAACGAGGATT
TGCGTGTCCAATCGCTGCTCGGCGGCTCCGAACGCTTCGTCGTCGCCGGTGACGAGATGGCCCCCCCAAAGACGCCCTCC
TCCGATACTACCGCCTCTCCACCATCCTCTTCCTCCACCCCCGACGGCCGTGTCTGGGCCTGGGATCTGCTCACCGGCAA
GGTCGTCGCCACCATCCCCGTCCCCTGGGGTCCCCCCGGAACCATCAACACCAGCCGGGCCATCGGCCGCGACGGCCGCG
AGAAGGAACGCCGCAACGTCACTAGCTGTCTGGCCTGGCAGGACGCTGGCTGGGGCGAGCAGTTCTGCGTTGGCGGCACG
TCTGGTGTCGTCACCGTCTTCGGGCCAAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62