GenePrediction:GLEAN_4769 Details

Name: GLEAN_4769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:470410..469484 (- strand)
Length: 927
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:470410..469748 (- strand)
Length: 663
Type: CDS
Source: GLEAN
Position: GCSC_167:469666..469484 (- strand)
Length: 183
>GLEAN_4769 class=GenePrediction position=GCSC_167:470410..469484 (- strand)
ATGACCACCCGGGCCCCGGCCTCGAAGAGCGCAGAGTTCGGCGACTATCCCTTTCTCACGGCCGACGAGTTCACCGAGGT
CTGCAACCAGCTCGACCGCATCTACCGCCATGCCACACTAGGTCCACTCCGGCGTCGATGGCGTCTTTCTGCCTGCACTG
CCTTCAATACCAGCTCGTATGCTGCCGGCAGCGAGTACACCACGTACCTCCAGATCACCCGCCCGCTGGATGAGGATGCT
GCTGCTGCCCTGGACGACAGCGACCTCTCCAGCCAGCTCGACCGGTTTTCTCTGGGGACGCTGGCCGTCAGCAGCGCCGA
TGTCGATGTGGAAGAGGACCAGGCCATGGCCGAAGACGACGAGGCCGACCAGGTGAGCAGGCAGTACAAGAGACGCACGG
GCCGCACAAGCACGTTCGCTCACACGACACAGGCTGTGCTGCGCAAGCAGCCGCCCGCGACCCGGCCGGCGGACGTGGGC
TTTGTGACCTACGAGATCCACCTCCATCCGACCTACAGGGCACCGTGTCTCTGGTTCTCTCTGCACGGACTGCCCGAGTA
CGAGCCCGCCTTCAGCATCGACACCGTCTTCCGGCGACTCGTGCCTGACTCGTTCAAGGACGGCCTCCGTGTTGCTGGCA
GCATCGGTGGCATCTCTGCAGACGTATGTACTGTTTGTATTTACCGTGTCTATCGTGCTCACCAAGGGCCTGCTGGAGGC
CTGGCTAACATGGCGCGTCCTTAGTACCATCCCATCACCGGAGTCCCGTCGTTCTTCGTCCACCCCTGTCTTCTCGGTGA
GGCCATGTCGGGATTTGATTGTTCCAAAAGCTCCTACCTCATGGTCTGGATCGGTCTGGTCGGTGGGTGTGTAGGCCTCT
GGGTTCCCAAGGAACTGGCCCTGATCCAAGACTGCTTTGAGACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62