GenePrediction:GLEAN_4778 Details

Name: GLEAN_4778
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:399638..398628 (- strand)
Length: 1011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:399638..399595 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:399342..399297 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_167:399155..399126 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_167:399027..398844 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_167:398767..398628 (- strand)
Length: 140
>GLEAN_4778 class=GenePrediction position=GCSC_167:399638..398628 (- strand)
ATGGCGTTGAAGCGCATTAACAAGGAACTCGCCGACCTCGGCCGGTACGTTATTGGGCCTCCCATGCCACCCTTCCCTAT
CATCCCCCAGTCTTCCTTCGCAGCCGCCCTTCATCTGTTTCTTTGCCGCCCTCAAAAATAAGGCTTCCAAGGTGGGGCAG
GGTTTTTGCGCGGGGCTTTTCCTTACTCCCCTCCCTTCATCGTCCAGCCATGACTAGGAGAAATCAGCATCACTGCTTTT
GCGACACATCTCTAGTGGCCTTCCAGGTTGTTACGTTGGCTGACTCTTTGCTACAGTGATCCGCCCTCCTCCTGCTCGGC
CGGCCCGACAGGCGATGATCTGGTACGTGACACATTTTTACCCTCGTGCACTTCTGCTAGTCGCCACTAGTCAGCTAGAC
CATCTGTCTTGGATCGCTGGCGGCGAAGCATTTTTTGTCGAGAGGCTTGGTTCCGCGTTTCGTCTCACTAACATGTGCAA
CAGTTCCACTGGCAGGCAACTATTATGGGCCCGGTAAGCCAAACAACCATGACCTCCCACACGCCACGAACGAACACATC
ACTCGTACGGTAACCACTTATTGGCCTTGTTACTGACTTCGCAATAAATAGAGCGACTCTCCGTACTCTGGCGGCGTTTT
CTTTCTCAGCATCCACTTCCCTACAGACTACCCGTTCAAGCCGCCTAAGGTCAACTTTACCACTCGCATTTACCACCCCA
ACATCAACGGCAATGGCAGCATCTGCTTAGATATCCTACGTGACCAGTGGAGCCCGGCCTTGACAATTTCAAAGGGTACG
TCGTCTTGTCAGCCCATTGCGAGCTAACCATCTCTTTGGTCTGAACGGTCGATTACTGACTTGGGTTGTAGTTCTGCTGT
CCATCTGCTCTATGCTGACAGACCCTAACCCGGACGACCCGCTTGTTCCCGAGATCGCACATGTGTACAAGACGGACCGG
GCCAAGTACGAGGCCACGGCGCGTGAGTGGACTCATAAATACGCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62