GenePrediction:GLEAN_477 Details

Name: GLEAN_477
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:71394..76831 (+ strand)
Length: 5438
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:71394..71529 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_97:71583..73380 (+ strand)
Length: 1798
Type: CDS
Source: GLEAN
Position: GCSC_97:73555..76831 (+ strand)
Length: 3277
>GLEAN_477 class=GenePrediction position=GCSC_97:71394..76831 (+ strand)
ATGTCGATGCCGTGGGGGAAGGCGGTCTACAAAAAAAAGGATGGGATCATAGCCGTCGCGGACGACCAGTCGCTGGTCAC
CTGGACTCCGACGGCAGGAGGTGCAGCAGTGTCTCTGCCTACTGTGAACATTACGAGTGCGTCAGCATACTGCCTCTCTC
CTCTCGCCTGCCGGTGCTGACATTTCCAGACCTGCAGCAGACGCCCGACACGGCAGCCAAGGTGATGCTGAAGATCTTTG
AGAAGCCACCAGGCTCCGACGGCGAGCCGTCGACCTACCTGTTCCACTTCAACTCGCCGACCGATGCACGAACCGAGGCC
AACGCGGTCAAGGACCTGCTCTCCAAGATCCTGGCCGACATACGCAGCAACGATCCGAGCGTGCCGCGGCCGGCGGACAC
GGCACCGCCAGCAGCACCAACGCGACCGGACAGCGGCAGCACATCCGCAGCCATGTCGTTTGCCAGCGCGACTACATCCA
AGCCGACGGTGGCACGCTGGTTCGACGACAGCCAGCTCCGGGCAGACATTGAGCTGCAGCAGTCGCTGATGAAGAAGGAC
AAGACGCTGCACCAGACATACATGGATGCGCAAAAGTCGAAGCCGGACTCGATCTCGGACGCGTCCTTCAATGGGCAGTT
CTGGTCCACACGCACAACGCTGCTGCGGGCACACGCAATCGAGACACACCAGAAAAAGGGGGCGTATAACGTGTTGTCGA
CGATCAAGCCGCGGACGGTCGACAATGAGCTCAAGCTCAACATCAGCGTCGAGCAGGTGCAGATGATTTTCAAGCAGCAC
CCGCTGGTCAAGCGGATCTACAACGACAACGTGCCGCGCATCTCCGAGTCGCAGTTCTGGGCCCGCTTCTTCCTCAGCCG
GCTGTCGAAGAAGCTGCGGGGTGAGCGCGTGCTGGATAGCGAACGGGCCGACCCCATCTTTGACCGGTACGACGAGTCGG
ACGACACCATCGCCGCCAGCCTGATCCTGTCGGCCCATGTGCCCTACACCATCGACCTGGAGGCCAACGAGGAGGACCAG
GGTGGCTTTCGCGGCGGCAACCGCAAGGACGTCGAGATGCGGCCGCGCTCCAACATCCCCATCGTCCGCACGCTGAACAG
TCTGAGCGAGAAGATCATGGCCGGCGTCGCGCCGTCTGACCCGGACCCGACCACGAGCGAGGTCGTCGACGCCGGCACGC
AGGCGGGACTGGAGCTGGCTGACCTGCGCGGCGATATCGAGGCGCGACGCATCGTACTCCACGTGCGCGAGCAGAGCCGC
TTCTTCAACCAGGACCCGGCTGACTCGGCCGACACAGACACATACCGCCAGCAGGTACCGTCCGAGGTGCTGTTTGACGT
GCAGGCCGACATCGACACGCTCGAGGGTGACGGCGCCGGTGGCATTGATCTGCATGCCGGCATCGGTGTGGACGAGGATA
GCGATAGTGATGGTGAGGATGGCCAGGCTCGCGGCAGCCACGTCGGGTCGCGCGCAGCGCGACAGGCGGCCCAGAAACAG
CTCTTTGCGGCCATTGCACAGCGGAGGTCGGAGCGGTACGGCCACAGCGCAGACGAGCAGGCGCCCATGGGCATCCCGGC
CGAGATCGCCCAGAAGGCGTACCTGACCAACGCGACCACGACCGAGTTTCTGCGGCAGTTCTGGAATGCCTTTTTGTCGG
GCGACGCCGACCGCGCGCAGGAACTGGCACACCACGTTGAGGCGCTCAGTAAATCACTGGGACGGATTGAGGCTATCGCC
GACGAGGCCGAACAGGCTCGTAACCGTGTCATTGCCGAGAAGAAGGAGGAGATCCGCGTGCTCTACAGTCGCACCGGCAA
GCGGCTGCGCTGGCGCCCCGAGATGATCGGTGGCGGCCGGCGCGCCGTCCAGGTGCTGCTGGGGCCAACCATTCACGGCC
TGCAGACAGCCCAGGACCGGTATCAGGCAGCATTGGCAGCCGAGGGGCTGAAGCTGAGCACGGAGTCGTGAGGGCTCCTG
GCTTTTGCTTAGATAATCCTGGCCACCTGTAGTTCGTTAGCCCACGCACTAGTCACAAGCTTGTATCCTAATTGGGCAGG
CGGTCCCACTCACCTCTTTCCCCCACTCAGACGCAGTGAAAATGTGAGGTTGACTCGTGCTCCCTGCAACACATTGTGCA
GGACTGCATATCGGCGCCAGAGAAGAACAACGAGCCAGCGCTCGTTCCGGTCTGCCCCCAGAAGCGACTTTCGCAACCCC
GATGCGCCGGGTGTCATGCGGCAAGCCTTCCGGATGCGCCCCATAGGGACGCCGGCCCTGCATGCGGCACCGAGCCTGTA
TCGATATCGATATCGATATCGATATCGAAGCATTGGCTCCTGGACTCTTGCATTTGCTCGCCGCTTCGGTCTCTCGGCCG
CCCAGCGAGCACGACCAGACGACGATGCGGCTGCCGAGGATAAGGCCCGGCCGGACGGTGACACCGAGAGCCCCGACGTT
CCTGTCATCTCGACCTCGTCTTCAACCTCGACATCCTCCCTTTCCTCGCCAGCTCCTCCACCAGAGACCGACAAGCCGAC
CGAGACAGAAGCACTGCGGGACGCCTTCTCCGGTCTCGTCGGCCGCGGCCGCTCGTCGAGACACCGCAGCCCAGATGGTC
TGCCACCCGTTCGCCTGCCCGACTGGTTTCTCCGCGAGAACGTGCGCCGCTGGGAGACGCCATCACTGCCGTCAGCCCAA
AACTCCATCAGCCACAACTTGGCCGAAGCTCGACGGCTGATGTTCCCCAACATTGCTCCCCAACCGACGACAGCAGCAAC
GCCACCGCCGACTGCCGTCCTGGACGCCGAGCGTGAGCGCATGCAGCAGTTCTTCGAGTGGATGCTCCATGGTGCTGCCT
GGGACGCGAACAAGGTGGCCGATGCTGCTGCTGATCTGCGGCGCGGCTATCTGGATGCTATCACGAACCGCAGCACCGCT
GTGGCTGCCGCTGCTTCGTACCTGACAGCTGCGCTCGCCGAAGAAGCCGGTCAGGCTGACCTGTCAGCCAAGATCGATCC
CGACAACGCGCTGCACATCCCCGAGGTGCTCTCCCGGCCGGCTTACCGCGACCACGTCAGGAGCCTGACCGAACACGGAA
TTGACGTGTGTGTCAGCCCTGGTGCTGACCAGGACGTGGCCCGCGGGCTGCCGTTCAACTACGACTACGGCGAGCGGATC
GGCTTCACGGAGCTCTGTGCCACCGTTGCCGCCGAGCTGCGCGCCGTGTCTCCTCCGGCCAGGCCGGCCAAAGACTTCAA
GCGGCCCATTTCCGTGCTTGCTTTGATGAATTATACCGGTCGCGGCAAGGCTGTCTCGGTCGTCGAAAACGTGGCCAGGA
GCCTCTCGGCTGACGTGGTCCATCTCGATGCTGCTGCTATCGCTGAGATCGTCGGCTCGTATCTCGGCCAGACGGCCTAT
TGGGCCCGCGGTAGCCTTTCGATGCTCGGCTACACCATGGCCGAGAAGAACGGCCGGCTGGCACGGCGATATCCGACCAA
GCGAGACGAAGAAGACGACGACGATGACGATCACCTGGACTCATCCATGGTTATGTCTCGGCTTCCAATCGCCTTTATGC
GCCAGTCTGGCCTCGGCCCGCGCCTTTCGTCCAAGGCCTTTCCCTCCGACATGGACGACAAGTGGGACGACCTGAAGACG
AACAACGTCCTCGAGGCTATCGTCAAGGCGACCACGACCACGACCACGACCACGACAGTCTCGGCTGAACCGCGCAAGAT
GATCCTGCACGTGCACAACTTCTTTGAGCTCAGCTCGACCGTCGAGGGCTCCGAGATCCTCGCCAAGCTGCGCACCATTG
TCGACCGGCTCTGGCAACGCCGCCACCACCGGATCGTGCTTGTCGGCTCGGCCTCAACCCATGCCGACGTCAAGCCCAGC
CTGGTCGAGCGGGCCGAGGAGCTGCGTCTCGAGGGCTACCACATCATCCCGTTCCGCGTGCAGCGCACCGCCTCGACGCC
CTGTCTGGCCGAGCAGATGGAGCGCCAGGACTACTTCAGCGAGAACATGGCCAACATCCGCGCCATGACGACCGCCCTGA
CGGCCGGCTCTCTGCAGCCGCCTGCCACGGCCTGGGACTGGGCCCGCTGCCGCGATGACGTCGACGAGACGCTGCAGGCC
AGCTTGTCGCACGTGGTCTATGACATTGACTGGGTGTACCGGCTGGTGACGTTAGTGCTCGGCAGCACGGCCGACAAGAC
GCCGCGCTGCGACGAGAAGAGCTTCGTGGCGGCCCTGCGCGCTATCGGCGGCGAAGAGCTGTGGTGGGAGAAGCGGGCCG
GAGCCAAGGCACCGTACTTCTATCCGCTGAGCACGACGCCAGACGCAGCCTTTGACCGCAGCAGCAGCGAGCCCGGCGAT
CCGCAGCAACAGCAGCAACAGGCTCAGACGACGACCGAGTACAACGAGTACGAGAAAAAGCTGCTGGCCAACGTGATCGA
CCGCCAGGCGATTGCGACGACGTTTGCCGACGTTGTGTGTCCGGCCGAGACAGTCGACTCGCTCAAGGCGCTGACGTCGC
TGTCGCTCGTGCGGCCCGAGGCCTTTCTATACGGCGTGCTGGCAACGGAGCGGATCCCTGGCTGTCTGCTGTACGGACCA
CCCGGCACTGGCAAGACGCTGCTGGCCAAGGCCGTGGCCAAGCAAGGTGGCGCCAGCATGATCGAGGTCAGTGCCGCCAG
CATCAACGACATGTGGCTGGGCAACAGCGAGAAGAACGTGCAGGCGCTCTTCTCGCTGGCCCGCAAGATGGCCCCCGTCG
TCATCTTCCTGGACGAGGCCGACGCGCTGCTGGGTGCCCGCCAGACCGGACCTGGTGGCCGTGCTGCCCACCGCGAGACC
ATCACCCAGTTCCTCCGCGAGTGGGATGGCCTCAAGAGCATGAACGCCTTCATCATGGTGGCCACGAACCGGCCCTTTGA
CCTGGACGAGGCCGTGTTGCGTCGTCTGCCGCGTCGTATCCTCGTCGACCTGCCGCTTCGGCCCGGCCGGCTGCGCATCC
TCGAGGTCATGCTTCGCGACGAGCTACTTGACTCGGCCGTCGACCTCAACCAGCTTGCCGCCGAGACTGAGCTCTACTCC
GGCTCTGACCTCAAGAATCTCTGCGTCGCCGCCGCCATGGAGGCCGTCCGCGAAGAGGTCCGCGCTCAGGACGCCCACGT
CGGCCCCGACCCGTTTGTTTTTGCCGACCGCCGCATCCTGCGGCGCGCCCACTTCGACCGCGCCCTGCAGGACATTGGCG
CCAGCATCAGCGAAGACATGGCGTCGCTGCAGGCCATCCGCCGCTTCGACGAGCGCTACGGCGACCGCCGCCGCAAGAAG
CGCCGCCACATGGGCTTCGAGGTCGCCCCGACCCAGCTCAACTCCGAGGCCGCACTGGTGAGACAGGCTGTGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62