GenePrediction:GLEAN_4780 Details

Name: GLEAN_4780
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:389652..387678 (- strand)
Length: 1975
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:389652..389610 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_167:388860..388534 (- strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_167:388468..387678 (- strand)
Length: 791
>GLEAN_4780 class=GenePrediction position=GCSC_167:389652..387678 (- strand)
ATGTTGCTGTCGTCATGGACGACTGCAGTTGTAATATACGAACGTATGCACCGTCATTCCGCCGGCACTGCCACGGATCT
ATTGATTTCTAACCGGTTCTTTCTGTGCAAAACGTACGAACGTGGCGGATTGGAGGCCGTGGGAACAGCATCACGTGATA
CACATAGTTGGTTAGGCCACCACACTATTCGTTGCCCGGCCTCGTTGTTGCCGTCGTTGTTTGCCTCTGTTACAAATTGC
CGTAGCTTCCTCAAACAGATTTCCACAACCCCTCCGTTTTCGCCCTACTGAACTTCCCTGTCGCCCCAAAGTGCCGCTTC
AGAACTCGCATCCTTTTTTCTCTTCTCAACTCGAAGGCTTGCCGTACATCAGGGCACACTTTCGTCCAAAATGTGAGAGT
GCCCGCCCGCTCTGCCTCGGCAGCTGCTGCATGTGCTGACAAGAGGGAAAGGCAAATCACAGTGACATTAGCAGACCAGA
GCAACGAGGACGATGTCGGGCTCCTCTTCCTGGAGGTGTTTCCTGAGATGACGATTGAGGCTCTCCAGAGTTCGATCCAG
GCCGAGACGGAGGTCGAGCCGAAGAACCAGTACCTCTACCACAACGGCCAGCTCATCACCGACGACTCGCAGACGCTGCG
GGACCTGAATGTCACCAATGGCGACATGCTGGCGATGCACGACCGCCGGAAAGGCAACGCAAGAGGTGGCGGTGGCGAGG
GATCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCTTCAGCGCCAACAACGAGAGCAACAAGCAACGGGTGCAGGCGGCAGT
GGGGCACAGCGTCGCCGACCGGGCGATCCAGACCCCGAGATGATTCGGCTACAGATCCTAGGTGACCCTCGGCTGCGAGA
AGAGGCACTGCGGCAGCAGCCACAGCTGGCGACGGTGCTGGACGACCCGCAGCGGTTTGCGCAATTCTTTGCAGACAACT
ACGAGCGCGATCGGAGGGAACAGCAGGAGCGGCAGCGGCAGATTGCGCAGCTGAACGCGGACCCATTCGACATTGAGGCA
CAGTCGCGGATTGAGGAGATTATCCGTCAGGAGCGGGTGATGGAGAATCTGCAGAATGCCATGGAGCACAACCCAGAAGG
TAGGCTTGGTGGGCTGTCTTGTCTTTGCGTCTGTAGAGCTTCCTGCTGACCCTGGCGTGTGCAGTGTTTGGCAGGGTACA
TCTGCTCTATGTGGACGTGGAGGTGAACGGCCACAAGGTCAAGGCGCTGGTGGACTCGGGGGCACAGGCAACGATCATGT
CGCCGTCCTGCGCGGAGGCGTGCGGCATCATGCGGCTGGTCGACAAGCGGTTTGCGGGCGTGGCGCGGGGTGTCGGCACG
GCTACGATCATCGGACGCGTACACTCAGCGCAGATCAAGATCGGCAGCCTCTTCTTGCCGTGCAGCTTCACGGTCATGGA
GGGCAAGGCGGTCGAGCTGCTTCTGGGCCTGGACATGCTGAAGCGTCACCAGGCGTGCATCGATCTGGTCAAGGACCGGC
TGATCATCCAGGGCGTTGAGATTCCCTTTTTAGGAGAAGCTGACATTCCCAAGGAGTCGGAGGAGGCTCTCACACAGGAA
CCAACCATCCCAGGACCCAGCGGAACAACGATCGGCCAGCGGTCGGGAGCTGTGTCGGGGACGGCGTCGGGGTCAGAAGG
CGAGGAACCGGCAGCAACGGCAGCAACAGTAGCACAAGCACAAGCAGGTCCAACGGGGGCTACATCCTCAGCAACGTCCG
CGCCGGCACGAGCAGTACAGCCAGCACAGTTACCAGGGCCAGCAGGGCCAACAGGAGCAGCAACGGCAGCAGGACCTGGC
CAGACGACATCTTTCCCGGAAGAGGCGGTTCAGCAGCTCATGGCGCTCGGCTTTCCACGCTCGGCGGCCGAGCAGTCGCT
GCAGGCCACAGGAGGCAATGTGGAGTACGCGGCCAGCCTGCTGTTCCAAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62