GenePrediction:GLEAN_4781 Details

Name: GLEAN_4781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:383228..379924 (- strand)
Length: 3305
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:383228..383102 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_167:382951..381938 (- strand)
Length: 1014
Type: CDS
Source: GLEAN
Position: GCSC_167:381825..381183 (- strand)
Length: 643
Type: CDS
Source: GLEAN
Position: GCSC_167:381086..381024 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_167:380913..380316 (- strand)
Length: 598
Type: CDS
Source: GLEAN
Position: GCSC_167:380265..379924 (- strand)
Length: 342
>GLEAN_4781 class=GenePrediction position=GCSC_167:383228..379924 (- strand)
ATGGATACGGAAAGCCGACATCCTGAGGCCAACCCGGACACCAACCCCTGTGACTCGGCTCCGGATGACACTGATCCTGC
TCCCAAGAAGTCCGCAATCAAGAAGAGAACAAAAACTGGCTGCTACAGTGAGCCTGGTCCCATACACCTTTAGCCCATTC
TCCCGCTAACTGCTTCCAAAGCATGCCGAAGAAGGCGGATCAAATGCGATGAAGGAAAACCGAGATGCAACAATTGCATC
AAATCGAAGAGACAATGCGAAGGTTATAATCAGCGAGTCATATTCAAGGACCCTATGGGCACCTTTCACCCGAACCAGAT
CGGCCCCATGCCCTTCCAGAGTGCTTCAGCCCACCACTTGCTCGCCAGCCAGCAAGGCTCCTTCGCCAGCCAGAACCCCA
GGGCAATCTCGCAAGGCTCCCTGCCGTTCATCGCGCCGCGGCCGCCTTTGATGAACGACGTCGCCCAGTACCAGCACCAG
CTTCCTCATCATCCCAGTATGCCCCCACGACAACATCCCCTTCACATGCAAGGCATTCCCGCCGGCCACGAACTCCATTT
TATCCCGCCAGGACATGCACAGCCCATGGCCCCGATGCCCATGTCCTATGCACCTTCGGCCCAGCCTGATTCTCATGGAC
ATGCATCCTTTGCGCAGGTCTGGGAGCCTCAGCCGCCCCTGACTGGCCATGGCGGTTCCTACGATGACTCTGGCTTCTTG
CCCTCCGTCGACTATGGTGGCCCTTTGACCGTGCCTATAGCGGTGCCTACGCCCGCACTTGTACCTGCTGTCGGGTGGTC
GTCCGATGGGAACTATGATGTTATCGACTTTCCTCCGGTCCCACGATCGCATGATTACACACGAGTCTTTGAGAGAGGCA
ATGCAGAATACTCAGCTCAATCGGCTATGCATTCGGAAGAGGGTTATTGGTACTCGGACGACGATGCATCCATGGGTGAT
TCTGAAGACGAAGAGGCAACAGACCAAATGGAACACGTACAGGCAAACGATCTGGGTGTAATTGTTGCAAGACGTCTGCC
AAACCGTCCGTTCGACGCCTTTGGCACTCAGCTGCGCACCTTTTCCAACTTTGCCGACGCAAATGTCTTGGCCGATTACG
TCCCATCGTCGCTGAACTCGCCCCTGACTGATGCTCGCACAGCCTCTGTCTTTTGGTACTTTGTTAATGTCACAGGACCA
AGCATGTCTCTCTTTGAGCGCTATCCCGTTGATCCCTCCCCCATTTTTGAAGGGCGCCCTGTACCTCGCTCAAGACAGCA
CATTTGGACATGTAGGACTCTGTATTTTTTTTCTCTATTCTCTTTTCTCTTTTCTCTATTTTTTTAGGGTTTTCTTGGTT
CTGTGTCTTCTTCTTTTCCATAGACTTGCTGACCTGGAATTAGATACCTTCCCTACCATCGCGCTTAACCACCCGGCTTT
GCTTCAAGCCATGCTGGCGTTGGGCAGTTTGCATATGGCCAAGCTCCAAGGCATTCCCGCCACTGCTTCGATGAAGCACT
ACCATCTGAGCTTGCGAAGGATTGCCCGCAACTACCAAAGCACATCTCGCCGTGTACAACCTGCCACGCTTGCCGCCACT
ATGCTTCTAGGCTTCTATGAAGTCTGGAACTCGGACCACGACAAGTGGTGCAAGCATATGTGGGGAGCGCGGGCTATCCT
GAGGGAAATTCCTCTCCGGGAGATGACCAAGAAGATGATTGCCCTTAAGCGGAAGCGTCGCCAGGCCCTCTATCAGGGCA
GCTTGGACCACGACTCAACGATGCCCGAAGACGGCATCGTTGCCGACAAGGATATTGATCTAGTCGACTCGGTTATTGTG
TCTCAACTCTCTGGATTGCCCGTAGGCTACGACCAAGATGAAGACGTGACCTCTTCCTCGTTTCACAATAGACGATCTAC
TTCTTGGACCACCCCTGACGCCTATACGGAGAAAGATATAAAAACATATCACATCCTCAGTGACTTATTCTGGTGGTATG
CGAAGATGGACGTATACCAGAGCATATTGGGAGGAACGCGGCTCCTGTAGGTTTCAGCCTCTTCTTTTTGCCATCTTTCC
TCTTGCCTCTGGACTAGTCTTTCGTCCGAGCGTCTTCTAACCGAGACGCCACTGCTCAATAGGATGGAATACAAGTGCTG
GACCCAATGCGCCCCTCGTGCCCCTATCAACAGGATCGACGCCTTGTGAGTGCCGGATAGCCGAGCAGAACTTCTTGGCG
CCATGGCTGACCACTCAGATACGGCACGTATGACCATCTCATGCTGCTTCTTGGTCGGATATGTGACTTTTCCAGTCACG
ACCAGGACCGTAAGCGCCAAGCGAGGTGGCCAGACGGGCCACCGGGACCTCGGGGCCAAGGCCAGTCGCCGCCACCTTTC
ATCGGCATGATGCCTTCGACGGGCAATATAACTATCCCCAAAGGCTTCAGCCCTCCGCGGGAACAGAGCCCTGAAAGCGA
CAGTCAGGAAGAGATGGACTTTGATGCAAGCACGACGGCAGCACTTTGCAAATGGGAAAGCATCAAGCAGACACTTGAAC
ATTTCCGGGCTCAATTGGGTCCCGACTTTGAGCCTTTAGGTCCGGAATACGAGCCTCCAGCAAGTAGTCCCTTTGGCCTG
GTGCTGAAGTACCGCACATATGGAATTGCGAGCATCTGGATGAACTACTACATGGGAATGATTGTGCTGCACCGCTGCCA
TCCATCAATGCCTCACATAGCCATGGCCGCGGCTGCCATGGCCGGGCGCCAGACAGCACCGTATGCCAACCAGATTGGCC
GCATCATTGCGGGACTCACCGTCGAAGATCTTAACACCATGGTGCACGTGAGCACTCTTCTCGGCGCCGTCTCCATCGAG
AGCTCATTCCCGCTGTTTGTGGCGGCCGTTCAGGTACTTCATCAATCTTCCGCTTCTGTCTTCTTTACGCTGATATTGTA
CAGTTTCAGGATACGGCGCAGAGACACTGGACGGTTCGACAGATGCACAATGTCGCTCGGTTGACAGGCTTTCAGTCTGC
CCGTCATATCGCTACCGGCTGCGAGACATGCTGGACGAAAGCTGCCAGCATGGGTCGCGGGCCGCCATACGAACCGCCCA
CAGACGTTGCGGAGGTTCCCCAGTCCATCTGGAATCGGCCAAAGAGAATTGTGGATCGGATTCGCGAGCTTGAGGAAGAA
GACGAGGAGCTGGTCTTGTCTGCCACCGAGCGATCCCGTTACGCCGTGGGATTACTAAGCATGGAGTCAGACCTCGAGAA
GCTGAAGCTAAGCGACAAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62