GenePrediction:GLEAN_4785 Details

Name: GLEAN_4785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:359836..358209 (- strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:359836..359484 (- strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_167:358290..358209 (- strand)
Length: 82
>GLEAN_4785 class=GenePrediction position=GCSC_167:359836..358209 (- strand)
ATGCACGAGATCGGCGAGACAGACAGGCGATGGACAGCAAAGCTGCAGGCAATCCTCCTCTCTGCTCGCTGTCGTCGTCC
TAGCCGACCTGGCGCCTGCCGGCAAGACCTAGGCCGGACCCAGGACCTTCCTGCTGCGAGCAAGCTGCTGCTGGGCATCA
CTAAGTTAGCAGGCAAGACGTGGCTCGCGTCTGTCGCCACCGTCGCTGCGACGCCGGAAGGCCCAGCCGGTGCCGTCGGA
AGCCCAGCAAGCTCGAGGCTAAACCTACGACGTACTCCGTACTCCGTATTACATAGTAGGATATGTAGGGCACGGCTTGC
GCCAGAGACGCTTGCGAGGCGACAATGGGCTCCGTACGACCATGTAACAAGACCATCGTGTAAGCAGACGGGCTCGGCTC
TCCGGCGGTGGAGACTCGGGGCTGTTCGTTCGTTCGGGCTGCCCCTATCAGCAGGCGCGGATAGCACTTGATCCTCTGCG
AACCCGGACGGCCGGCCAGTCACGGCCGCCCAGGTGGGCTGGCCAGAAACGACGGCTTCCAGTCTAGAGCTGCTGCTGAG
ACATGGTCGCTGCAGGGCAGTGGAGAGGTGGAGAGAGCGAGCAGTACATAGTAGCTGCTGCTACCGCGTATACGATCAAA
GCATCATCCGTACATGGAAAAAGGGCAGCACGGCCTGGTCGTATTCTCGCTGCTGGGGCGTATGGGGAACGAGACGGCGG
CCACGACTGGCCGAGACGACCATGACAGATCAGACTGCATTGCCGGCCTGCAGGCTTGGTGGCATGGACATGGGGGAGGA
GGAGACTGGTTCTCTTGGGCCTCCAGTTTTTGATATTCTCTTATTGGCCATGCTCCTCGCTCTCCTCGTGTTTGTCCCCT
CTGGCTCGGCTTCATCCTGTCTTGCCGACGTCCAAAACGATTCTCCTACTGTGACCAACTGCCTCGGCCCTGGCCGATGG
CTGTGCGTCCTTTTTCCCGTTTCTTCATCTACTGTTGGATTTCGGGATCTGTCTGTATCTCGCCATCTCACCACCACCCC
CGTAAGCGAGAGAGGGTAAGGGCACGAACGTATAGAGTAAGCTATTCGTAGAGGGCAAAAAGACCGAGCTCACTGCGACC
CCCCCCCCCCTCGCCCCCCGGCGCAGATCCTTCGAGACCATTCGTCGACCACGGCTGGTGACGTGTGGCTGGTGCTCGTG
TATTGGAGGGTATACAGGATTTCTGTAAGAGAAGACGGAGTTGTCGGACATTAGCTTCCCCTTCAAAGGATCATGTTCAT
CGGAGCACTGACAAAAGCAGGCCAAAGAACTTGTTTGCTTGCCAATTGCGTGCAAGCTAAGCTATCTCGACATCGCAGGA
AGGCGTGCAGAAAGTGTTCCCACGCCCCTCCCCCCCCTGCTGCTTTGTTGGCAGAGCGCGCGCGAAATACGCATTATCAG
CTCGATATACGAAGCACGGCATGTTGCCGTGATAGTGGGTCTGGAACGGCGGTCAGTGAAGAATGCTGGAAGCCGGGGGG
CGCTGAAGGAGACACTATTGGAATAGGAGGGAAAAGGAGGGGCAGCACGATACAGTTACGAATGAATCTGGCGACGGCGC
GGCCGTTAACGTTACGCTCCTGCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62