GenePrediction:GLEAN_4786 Details

Name: GLEAN_4786
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:355978..353188 (- strand)
Length: 2791
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:355978..355596 (- strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_167:355442..353347 (- strand)
Length: 2096
Type: CDS
Source: GLEAN
Position: GCSC_167:353291..353188 (- strand)
Length: 104
>GLEAN_4786 class=GenePrediction position=GCSC_167:355978..353188 (- strand)
ATGTCTTTTGACTACAACAACGCTGCCGCCGGTGGAGAGGCTGCCTTTATCGATCAGTTCTACCCATACAACACCTCGCC
CGCCACCACATCGCCGATGACGGCCGCTCCCTCAAACGCCTCATCCGCCATGGTATCTCCCACAAATAGCCAGCAGGCGG
TGGCCTGGGCAATGCCGTACGACTACACTACCGGTCCCGTGGCCCCGGTCGTGCCTTCGACCGTACAATCTCCCATCGAA
GCCGCGGTCTCCTCGCCCGAAGACTCGCGGCATAGCCTTTCGCCCGGCCACATCAGCTCCGTCACGTCCAGCCCACCCCA
GGAACTGCTCTCGCTCTCGCCCTTCCAGAATACAAATGCAAACACCCCGGCCATGCTGACCGAGTGGACGCTGCAGCAGA
GACAGCGCCAGCTTCAACATCAGCATCAGCAGTTGCAGCAGCAGCTTCAGATCCAAATCCAGCAGCAGCGCCAGCAGCAA
TACCAGCAGTCGCAGAATCAGCAGGCCACCCAAGACCTGCAGCCCTACATGCAAAGTCAGGCCCTCATGAGCTTCAACCC
CTTTGCCACGGCCGACTACCAGAACTCGGCGCTGACCTACCCCGCTGCCGCTACCACCACGTCCGCGCTCGACAGCCTGA
CGGCCTACCACGGCCTCCCTACGGTGACTGGTGCCGATGCCGCCAGCGCCACTCAGGCCTTGCAGTGGAATCTCGGCATG
GCCAACTGGCAGGACTTTGATGCCGCTGCCGTTGTGATGCCGGCCATTCCCACCCACGGCCTCTCGCACCAGCGCATTGG
CAGCATGACTAGCCTCGGAAGCAATTCCCCCACCGGCACCTGCATCGATGTACACTCGCTCGGCTCGAGTGGCGACATGG
GCTGGGCCACGGTGGATCTGTTTGCCCGCATGGACAACTTCCCGCCGCCCGGCTCGCAGCACCCGCACGATGTCATCTTC
AACCCTAGCCAGACCCTCCACCTGCGCTCCAACTCCGGATCCTCGCAGGCGCAGTCGGACGGCACCTCGTTTGACTACGG
CAGCTATGAGGAGGTCTCGTTCCCGCCCCCGTTCTCGCCCTACTCGCAAGACTCGGACACCTGTCTGGACGGCTCAGGCA
ACCACCGCAACTGCTTCCACACAGACGTTCCCGCCGACCACCAGCATCAACACGTTCACCAGCACCAACATCAGCACCAG
CACCGCCACGGCAACCCGCATCAGCACCACTCCCACGAGCTCATCAGCCCGGCCGCCGTCGTCGCGCCCATGCCTATCAA
GGCCGGCACGACGTCGCATCCGTCTTCCAACCGCCAGAGTCCCGCAGCCGGGTCTGGTGTCGGCTCAACCGCAGCGTCTG
CGTCGCCACCGGTGCGTCGCTCGTCGGGTGTCCGCAAGAGCCCCACGGCCCGTCCGTCCAAGGCGGTCGTCCGCCGTGCC
TCCACCGGCAAAGACGGTCGCGTCGGCGAGAAGAAGGTTGGTCGCCGGCGGGGTCCGCTTCTGCCGGAGCAGCGCAAGCA
GGCTAGCGAGATCCGCAAGCTGCGCGCCTGCCTCCGCTGCAAGTTCCTCAAGAAGACGTGCGACAAGGGCGAGCCGTGTG
CCGGCTGCCAGCCGTCGCACGCGCGCCTCTGGCAGGTGCCGTGCACGCGCATCGACATCAAGGATGTGAACTACTTCATG
AAGGACTGGAAGGCCGACTACTCGCGCCATCTGGACCGCGGCGTGTCCGTCTTCAATGTCAAGGGCTTTGCCCCCAAGGA
GCGGCTGATGTGGATCACCCACGGCTACGGCTTCTGTCTGCCCATCATGGTCCGCGAGGTCTACGTGGCCGATGACAGCT
GCTTCCAGATCGACTGGGTCGAGTCGCACCTCACGGAGCAGGAGCCTATCGAGTACGACGTCCGCACGGAGCGTCTCGAC
GTCGGCCAGGATGGCATCAGCACCGAGAAGCTGTCCGAGTACCTGGACCGCCACATTGACGGCACCTTTGAGCACTTTGT
CGACGACCACTTTGACGGCACCCCATTCGTCACCGAGATCCTCAAGACGGCCCACCGCTACTACATGAAGCAGGGCCAGC
CGGTCATCCGCAAGGCGCTCAAGCTGGTGCTCGCCTACAACCTGACCATGCACATCACCCTGGTTGAGCAGCAGGGCTCA
GAGGAGCCGCCCATGGAGGGCCAGATCGACGACGAGGACTCCAAGTTCTACGGAAAGGTGGTGGCGCCCGTCATGATCAA
CTTCCAGATCAAGTGCGCCATGGCCGACATGTGGCGTGAGCTGCAAAAGGAGATCCTCGAAGAGCTGTCGAGCCTATACT
CGAGCGTGTACAGCGGCGACCGTCTGAAGAACTGGCCGACTATCTTCATGCTGGCTGCCATCCTGCTGATCGTCTGGGAG
GAGATGCAGTTCGACTGCCACTACCGCGTGCCTGATGCCGCCTCGGTCGGCAAGTTCTGCGGCGACATGGAAGGCACTCC
TGTCGGCGTCGTCGTGGGCCTGTTCCATGCCATCTCGCAGAAGCTGCCAGCTTTTACCGACTGGGATACGAAGCGTCACG
GCCAGGTGCTGAATAACAACGAGGCCGTGTGCGAGGCCATGACGGAGGTGCGGCAGCACATTATGAAGCACGGTGAGCAG
GCCCCTTATCCGATTCAGTGACTCGTTTGCCTTCTAACTCTTCGCAGATACCTACCTCCGTGCGAGACCAAATAACACAG
AGTTTGACCGCTACGACTTCGACTCGCTGTCGAACAAGTTCCTGTCGAAGCTGGTCATCCGGGCCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62