GenePrediction:GLEAN_4787 Details

Name: GLEAN_4787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:349668..344181 (- strand)
Length: 5488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:349668..347653 (- strand)
Length: 2016
Type: CDS
Source: GLEAN
Position: GCSC_167:346679..344181 (- strand)
Length: 2499
>GLEAN_4787 class=GenePrediction position=GCSC_167:349668..344181 (- strand)
ATGCCTCGTTCGCACTACTACCATCTCAAATTCGAGCTTTACGCGACGCCTGATCTGACGGGCGCAAAAACAGTCGAAGA
CGGGCTGCGACATCCGGTGTGGCAGCCTGGGCCGGGGGCCAGCATCTTTGACGACCTGCCGTCACACTACTCGGAAGCAC
AGGCGGGAAGCGAACAGGGCGAGGGTGAGGGGGACGAGCCAGACGTGGGCGAGCAGGACGCGGCGACGGCGAGAGACTGG
CGATTTGGGAACGTGTGGATTGCCAGCTTTGATATGGAGGACAGCTATGGAGGCAGCCATGGAAAATCGGCAGAGTCGGC
AGATGCGTTAACATCAACAGCATCAACAGCATCAACGGCATTGGTAGCGACGCCAGCATCGTCGTTGGGGCCGATGCTGG
GAGGTGCGGGCCAGGCAACGCGGGCACGGTACAGCCAGCTAGCGACCAAGACGACCGATGCGGGCTGGGGCATTGTGCAT
CTGTACCGGGAAGGCGGAACGGCGGTGGCAATGCGCGACTCCAGCGGTGGTGAAGAGGACGGCAGTGACGGGACGATGCT
GTGCATCCCGGCGGTGCCGAGCTACCTGACGCCGCGCGACTTTCTCGGCTTCGTGGGCGAGCGGTGGCGCGGCGACGTCA
GCCATTATCGCATGGTGATGACGAGCCGGACGAACCGTTACATGGTACTGCTCAAGTTCCGCGAAGCGGCGCGGGCGCGC
GAGTGGCGGGCTGCCTTTGACGGATGTGTGTTCAACAGCATGGAGGCGGAGATTTGCCATGTGGCCTACATCCGGTCGAT
CGGCATCGAGACACCGGGGCGGTGGCGGACAGCGGCCAACAGTGAGGGAAGGGGTCACTCATCCGGCTCTCCGCGGCCGT
TCCCACCACCGACACCAAACCTGATCGAACTGCCGACGTGTCCGGTCTGCCTGGAGCGCATGGACGACACGACTGGTCTG
ATGACGATTCTCTGCCAGCACGTCTTCCACTGCACCTGTCTGCAAACGTGGAAGGGCTCCGGCTGTCCGGTCTGTCGGGC
GACCAATCCGCTGCCGACGGTGGAAGGAGGTGCAGAGGACAAGAGCACGGGCGGTGCGGCAGGGTCGTCACCTAGCAAGG
CGACGGCGCCGCCATTTGGGGCAGGCGTCTCCAATCTGTGCGCGGTGTGCGACTGCGCGGACGACCTGTGGATCTGCCTG
ATCTGCGGCAACGTGGGTTGCGGGCGATACAAGCGGGGCCATGCCAAGGACCACTGGAAGGAGACGGCACACTCGTTCAG
CCTGGAGCTGGAGACGCAATACGTGTGGGACTACGCGGGCGACATGTGGGTGCACCGGCTGATCCGAGCCAAGGGCGACG
GCAAGGTGGTGGAGCTGCCGGGACGATCGAGACGGCGAGGAGGAGAAGGGGGCACGAGGGGGCAGAGAGTAGGAGAAGGG
GGGCGAGTCAACGAGGACTCGAACCCGGACTCGGACAGCTCGGACGACGCGGACGAGGGCGACGACGAGGAAGAGGTGGT
GCCGGCAGCGAAGCTGGAGCGGATTGGGCTGGAGTACACGCACCTGCTGACGAGTCAGCTGGAGAGCCAGCGGGTGTACT
TTGAGGAGCTGGTGAGCAAGGCGGCAGACAAGGCGGCAGCGGCAGCGGCGACGGCCGAGCAGGCGGCAGCACAGGCGGCA
CAGACGACGGACGAGCTGCGGGTGCTGCGGGCGGCCCATGACATGCTAGCCCAGACGACGATGCCGGCACTGGAGCGCGA
TGTCGAGCGAGAGCGGCGACGGGCCGACAAGGCGGCAGAGCTGGCACGCAACCTCGGCCGGTCGCTACAGGAGGAGAAAC
GGGTGTCGGAGGGCCTGATGACGCGGATCCGCCATCTGCAGGACCAGACAACACAGGCACAGGCACAGGCAGCCGAGGCC
CTGGCAGCACAGGCGGAGCTGCAGGAGGCCAACCGCGATCTGACCATGTTTATTTCGGGACAGGAGAAGCTGCGGGAGTT
GGAGGCCGATGGACAGGTGGCAGCAGGCGAGCTGGAGGAGGGGACGGCGAGCGTGCCGGAGGAGAAGAAGGGCAAGGGCA
GGAAGGGGAGGGGAGGAGGAGGGGGAGGGAAGAGGTAGGTGGTAAAAGTAGCAAGAGGGAAAGAAGGTGAGATGAGATGT
CTGAAAGGCAAAGTTTCTGATTCCTGAAGGCCCCATTTGCAGAGTACGGAGTAATCATATGATATTAGCATGCTCTACGT
TAGTCTGTCTAAGAATATAGCATATCAATTCGTTGAAACAAATCTTACCCAAATATTGTTCAACATATCTGTACTCACGC
CTATTCCGGGGAACGATAAGAGGTCGGCTCCCGGTTTGTCAGCGGCTGCGGTCTTAGTGATCTGTGGCGTTTGGCTCCCC
TCATCCGGCTTGTTGGGGCAGGAGCCTTGTTTTGTTGGGCCAGACATAGTCGGGGACCGTGCTGTACGGGGCACGTGCTT
AGTCGTCCGCATACCTTCCTTTTCCGATCGCACAGCCTTGTACGGAGAATGGCGCTGCTCTGTCGCTGCTACTTGCAACT
TCCAACCCAGCTTTGTCCTAGATCTCTCTCGCTGCAAGAATCCCGCAGGTCGACATAAAAACGGGCGCCGATCGCACTTG
CCTTGGCCGCAGCTGAAGCAACGTGCCCTACTCGAAAGCATCGTATTTTGGACTGGAAATCCGCGTATTTTTTCTCTTTT
CGGCTCTTGAGCTTCTTCAGCTGGTTTCGCCATCGCCCCAATACGACCTCTGCTCCGTGGCAGCGGCAGGCGTCTGTGCA
GTGTCCGGAGGATAAAAGCGGAGCGACTCATCTGGACCGAGCTTACGGGGCTTCTGTAATGTGGTCTGAGCATCTTTTTC
TGCCATTTTCTCTCTTATTTAACTCGCATTTCCTACCCCAGACAAGACTGCTGCCAGTCTGAGCCAGACCCCTCCACCCT
CCACCGCCCCTCTGGGCCCCCGAGCATAGGCCGTCCCGACCGGATCCGCCGGCGAGTGCGTCTCGTGTCTCTCTTTCTGC
ACTCTTTCTCGCGACCGTGTCCAAGCCCGGACACGATCTCTCTCGGCTTCCTCGCTTCCTCGCTTCTCGACCGAAATGGC
AGAGGAACAGAAGACCAACGGTGCCGTCGTGGCGGACGGACAGGCGGAAAAAGACCTGTACCCGATGAGCAACTGGAAAT
ATGACACGTTCCTCTGGACCATGTCGATCCTGGTCGACCTCTTCTTCCGCGAAGTGCATCCACGGGGTTCGTGGAAGATC
CCGCGTGACGGCCCGGTGCTCTTCGTGGCAGCCCCCCACGCGAACCAGTTTGTGGACGCGCTGATCCTGCAGCGCACACT
GCACAACGAGGCCAAGCGGCGGGTGTCGCTGCTGATCGCGCAGAAATCCGTGCACGGATTCATCGGCTGGGCATCGCGCC
AGGTTGGGTCGGTGCCGGTTGGCCGAGCACAGGACTCGGCCAAGCCAGCTGCCGGCACCATATACCTGCCGGACCCGGTC
AACGATCCGACGCTGCTGCGTGGAGTCGGCACCTCGTTCGACACGGTGGCGGCGGTGGGCAGCATGATCTTCCTGCCGTC
GGTCAAGGGCAAGAGCGGGTCGAGCGTGGACATTGCGGAGATCCTGGGGCCCGACACTGTCCGGCTCAAGCGGCCGTTCC
AGGGCCGGACGTCGATGATGCAGCTGACCGGCTGGACGGCCATCACAGACCTAGACGAGGACGGGCACTTTCTCGGCTCG
ATCTCGGGTCCGGCGCCGGGATTTCAAGGTACCAAGTTCAAGCTGGCAGCCCACATCGACCAGACCAAGGTGTACCATGC
CGTGTTCAACCGGCTGCGCAACGGCGGCTGTGTCGGCATCTTTCCCGAGGGCGGCAGCCACGACCGCACCGGCATGCTGC
CGCTCAAGGCCGGCGTGGCAATCATGGCTCTGGGAGCACTGGCTGAGTCGCCTGACTGCGATCTGCGGATCATGCCGGTG
GGCATGAATTACTTCCACGCACACAAGTTCCGGTCGCGGGCGGTGGTGGAGTTTGGGCCGCCACTGTCGGTGCCGGCCGA
ACTGGTGGCCATGTACCGGGATGGCCGGCGTCGTGACGCGATCGCGCAGCTGCTGGATATGGTGCACCAGGCGCTGGCGG
CCGTGACGGTGTCGACGCCCGACTACGACACGCTGATGCTGATCCAGGCGGCACGGCGGCTGTACAACCCGACGGGCAAG
AAGCTACCACTGCCAATGGTCGTGGAGCTGAACCGACGACTGGCCATGGGCTACGACAAGTACAAGGACGACGAGCGGGT
GCGGGCAGTGACCGAGGCGGTCAAGGACTACAACCGGCAGCTGCGATACCTCAACATTCGCGATCACCAGGTCAACTACG
CGCGGCTGCCGTGGTGGAAGGTGTCGGCGCTGTTTGTGCTGCGACTGGTGCAGCTGATGGTGCTGTCGGTCGGCGTGCTG
CCGGGGCTGTTGCTGTTTGCGCCGGTCTTTGTGGTGACAAAGCTGTACAGCCGGCGGAAGGCAGCCGAGGCGCTGGCCGG
ATCGTCGGTCAAGATCCAGGGCCGCGACGTCATGGCCACGTGGAAGCTGCTGGTGGCCATGTTCTTTGCGCCGATTCTGT
ACAACGCCTACTGCGTGCTGTTTGTGATCAAGTTCGGGTCCGACCGGCTGTGGGGCTACGTGCCGGCCTGGGCAACCGAG
GCGCCCTGGTGGCTGGTCTTTCTGACTGGCTGGATCGTCTTTCCGCTGATTACGTTTGCGGCCTTGCGTTTTGGCGAAGT
CGGCATGGACATTGTCAAGTCGTTGCGGCCGCTGGTGTTGTGCATGATCCCGGCCTCGAGCTACAACATCCACAAGCTGC
GCGAGCGACGGGCCGAGCTGCAGGTGCGCGTGACCGACCTGGTCAACACGCTGGGCCCCGAGATGTTCCCGGACTTTCCA
CACAAGCGGCTGGTCAAGGTGCCGGTGGGCAACGGCGACGCACGGCTTTCCGGCAGCACGACATCGCGGCCTGCGACGGC
GACACAGACGACGACACAGACGACGACACAAATGTCACCGCCCTCGGTCCAGCACCGACGCCACGACAGCGAGCAGTCCA
GCGGCAGTGGATCGGGCACCGGCACCGGCACCGGGATCACCATCACCGTGGGCGCCACACAGTCAGGCCGTGCTGTTCCG
CGCAACGAGTCATTCAGCAACATCGGCAAGGTGGGCATCTTTCCGACACGGCCACCGTCGCGGTCGCGGTCGCGCAGCAG
CAGCGCAGGCGGTGGGTTTCCCGTCAGCGGGTTCACCACACTGGATGCCAACGGCGGCTTTGACGAGGCCAGCAAGAAGA
TCCGCGAGGCGATGCGGGAACGCGGCGAGCTGAGGCGACGACAGAGCCAGTCGGCCAAGGACTTTTCGCTGATGGCGGAC
GAGGATGAGGAAGAGGAGGAAGAGGGTGAGGAGAAGCAGGACGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62