GenePrediction:GLEAN_478 Details

Name: GLEAN_478
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:90373..91199 (+ strand)
Length: 827
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:90373..90610 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_97:90848..91041 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_97:91113..91199 (+ strand)
Length: 87
>GLEAN_478 class=GenePrediction position=GCSC_97:90373..91199 (+ strand)
ATGTTCCGCATCCGGCCCACGACACTGGTGCGCGCCCAGCGTGCTGTGCTGCAGCAGCCCCAGGCTGTTGTGGCCTGCCG
TGCTGCCTCCACGCAAGCCATCTCCAACCCGACCCTGATCAACATTGAGAAGAGGTGGGAGGGCCTCCCGCTGCAGGAGC
AGGCCGAGCTCTGGATGTCCCTGCGCGATCGCATGAAGGAGAACTGGAAGGAGCTCACAGTCCAAGAGAAGAAGGCTGGT
AAGTCTGGTCTCTCAATGGTCTTTCAATTGTATTTTGCCGACCTTTCCGTCGGGCCGGACGCTTGATTGCATTCTTCCTG
AATGAGCACCACCCCTCTTCGTAGTTGCAATCGCAACTGTTATACATGACCAAGTCCCTGCAAACTTCACCGACACGTGT
CTATGCCATGCAGTTTCCTCAATTCGCCCCGCTGGCTTTAGAAAGCTTTAACTGACAATTGCCTTTGTCGTACAGCTTAC
TGGATTGCATTCGGTCCCCACGGCCCGCGCGCTCTGCCGCCACCGGGTGAGGGCAAGAAGGTTGCCCTGTACACCGCGAT
CGGTGTTGGTGCCAGCTTGCTGCTCTTCTCTGGCATGCGGCTGTTCGCTGGCCCGGCGCCGCCCACCATGAACCGGGAGT
GGCAGGAGGCTGCCAACGAGAAGCTCAAGGTACGGAATTGGGGCGCGTTTGCGGTAGTGCGACTCTGGAACAATGTGCTA
ATATATCTCCCCGCCTACAGGAGCAGAAGTCCGACCCGTTTACCGGCATTGCTTCCGAGGGCTACGCGGGCAAGGGCCAG
ATCCAGTCGCCGCCTGCGAGCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62