GenePrediction:GLEAN_4790 Details

Name: GLEAN_4790
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:336094..335167 (- strand)
Length: 928
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:336094..335843 (- strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_167:335751..335167 (- strand)
Length: 585
>GLEAN_4790 class=GenePrediction position=GCSC_167:336094..335167 (- strand)
ATGGATTTTTACCAGGAGCAGCATAGCTACACCCTTGCCCGTAATGCCAATATCGACACGGACTCTGACGAGGAGACCAG
TTGGGTTATGCTGGACCAGGAGGGCGACGTTGTGAAACTCCCTGGTGAGAAGGTCTATTATAAGGTGCGCTCTCGCATCG
GCCTCGACATCGGCACTCCAAAATCGCTGCCGAATACCACCCCGTTCTCAGCCAAGAGTGACAGTGGTATTGTTTATATC
ACAAATAACAGGGTAGGTGGCAAAATGCTACAGTACCGTGCCGTCGTCCGCATGCGTACCAATCGACCACCCTGCTGACC
CGGCCGCTTGGTGCGGCGTCTAGGTCATCTACCTGCCGGCCAGACCGACCGGGGCCTTCAAGTCCTTTTCTGCTCCGATC
CTGGACTTTGAAGACACTCGCGTCGTCTCCAGCTTCTTTGGCCCGTGGTCGTGGTGCGGAATTGTGCGCCCTACTGTCGG
CGGAGGTATTCCGCACGACGTTCCGCGGCTGGAGTTTAAGCTCACCTTCAAGGATGGCGGCCACGATGCCTTCCAGAGCA
AGTTTGAGGTGATGAAGGAGCGTTTGGCCTATGCCCGAACGCTGCAGCAGGAGACTGGGCAAATCATCCCCACCGGAGAG
GACCTCCCCAAGTACGAGGCCACCCTGCCAACTGGAGGAGCAGGACGACCACCAGCGCCAGGCGCAGCTCCTGGACATTC
AGCGTCGTCATCGACAGGGGTACCGGCAACGTCCGACTTGCAGCAGGCTGAAGAGCCGGCACCAGCACTGACAGCGGCTC
CGGATGCCGGCCATGGATTTTCCCAGGTCACGCCGGACGAGCCGCCTCCGGACTATGAGGAGGCGCAAGCCCAGGCCCTC
GGAATGAGGCTCGAGGAGAATTTACGGGAGGCGGCCGAGAGACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62