GenePrediction:GLEAN_4791 Details

Name: GLEAN_4791
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:334569..333953 (- strand)
Length: 617
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:334569..334365 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_167:334190..334092 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_167:334017..333953 (- strand)
Length: 65
>GLEAN_4791 class=GenePrediction position=GCSC_167:334569..333953 (- strand)
ATGGGCATCTGGGACACGTTCACGGACCTGATTGAGGCGGCGACGCCATGGAGCGTGGCCGAAGCTGAGGCGGTGGCCGA
GCCTGTGCAGGAGGAGACGGCAGAGGAGCCCAAGAAGGCTGAGGCCGAGGCCGAGGAGGAGGCAGAGGAGGCCGAGGAGG
AGGAGGAGGAGGAGCTGGTCGACCCCAAGGAGACTTTCGAGGAGGGTAAGCTACTTTTCGGCTTCGAATTGGAAGGGAGG
AAAGGCGGACAAGGCGGACAAGGCACACGATGTGGCGGAGCTCGCGGCCGGCCGTGATCTGCCGTCAATTCGCCTTTCCC
CTCATTCCAATGCGAATGCCTGTCGGATCTGTGCGAGGGACAATTGCTGACGGAAGCAGAGTGCCGGAACTCCAAGGAAT
GCAGCCCGGCCAAGCACCACTTTGAGGAGTGCGTGGAGCGCGTCGAGAACGGCAGTCAGGAGGACTGCGTGGAGGAGTGT
ACGTGTCCATATCCATGTCCAGGTGCATCTTGCACGTTGTCACAGTCAATGTTCAACACTGACAGCTTCTAGTCTTCCAC
CTGACCCACTGCGCGACCCAATGCGCTGCACCGAAGCTGTGGGCAAAGCTCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62