GenePrediction:GLEAN_4792 Details

Name: GLEAN_4792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:332367..330605 (- strand)
Length: 1763
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:332367..332050 (- strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_167:331923..331444 (- strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_167:331384..330605 (- strand)
Length: 780
>GLEAN_4792 class=GenePrediction position=GCSC_167:332367..330605 (- strand)
ATGGCCACAGATGCCAGCGACTGGCAGGAGGACAAGGCGTTTGAGGACGCGGACGGTGCAGGCATCACGGCCGAGGTACA
GGAAACGCAGCCGTCTCACGGAAATTCCGAGGACGGTAAGGTGGAGCTGGCCGGGCTGCTGAGGCCGGACGGACAGATGC
AGGGCGACGGGATCGGTGCCAACGGTACAGTGGTGGCTGGCAGCGGCGACAGGACGAGTGGCGATGCGGAGGCGGGGCCG
CCCATATACCGGGTGTACAGGCGGCGCTGGTTCGGGCTGATACAGCTGACGCTGCTCAACATTATCGTGAGCTGGGATGT
GAGTGTTTTGTGTTTTGTGTTTTGTGTTCCTGCGATTTCTTTGTCCGTCCCATCTGTTCCTTCCTCGTCCTTCCTCGTGT
TCCTTCCTCTGCTCTTCTCCCTCGCCCCTTCCTAACGTCCGCAGTGGCTCACGTTCTCGCCTGTGGCGTCGGACGCAGCC
ACATTCTTCCGCACGAGCGAGTCCAACATCAATTGGCTCAGCACAGCCTTTCTCTTTTCCTTTTGCGTCATCACGCCACT
GGTGATCTATACGCTGCACTTTGGTCCACGGCCGGCGATGATCGTGTCGGCCGTGCTCCTCCTGGTCGGCAACTGGATCC
GCTATGCGGGCGCACGCAGCAGCCTGAGCGCCGATGGCAACACGGGCGGCCACTTTGGCGTCGTGATGCTAGGGCAGATC
CTGACGGGCCTGGCCCAGCCGTTTGTGCTGGCGGCTGCGGCACGCTATTCGGACCTCTGGTTCACAAACCGCGGCCGCGT
CACGGCCACGGCCCTGATGAGCCTGGCCAACCCGTTGGGCGCCGCACTGGGCCAGTTGATTGTGCCTTTCTGGGTCAACC
GGTCACATGACATTCCTAACATGGTGCTCTACGTGGCCATTATCGTGAGTCTGCCATGTTCGGCTTTGGGTTCTCGGGTT
TCCTTTCGCTTGCTGACGGCCAGTCGTCCATCTGCTCGGTCCCATCCTTCTTCGTGTACGACAAGCCGCCGACGCCGGTG
GCTCCTTCAGCCGAGACGACCAAGGCCACATTGCGCGAGTCTTTTTGGCTGCTGAGCCGTTCGGTCGAGTTCTGGCTCAT
CTTCATCCCGTTTGCCGTCTTTGTCGGCTTCTTCAACTCGGTCTCGTCGCTGCTCAACCAGATCATGGAACCGTACGGCT
ACTCGGACGACGCTTCGGGCATCGCGGGTGCCGTGCTGATCATCGCCGGGCTCGTCTGTGCGGCCATCACGTCGCCCATC
CTCGACCGAACCAAGAGCTTTCTGGCCACGATCAAGATTTGCGTGCCGGTCGTCGGGCTCTGTTACCTCGCCTTCATCTG
GATGCCGCAAACCCACGACCAGGGCGGCCTTGCCGGACCCTATGTCGTCCTGGCCGTTCTCGGCGCTGCTTGCTTCACGC
TCGTTCCCGTCGCCATCGAGATGCTCGCCGAGCTGACACACCCGGTCAGCCCCGAGGTCACGTCGACGCTCTGCTGGAGC
GGCGGCCAGCTGCTAGGCGGCATCTTCGTCATCGTCTCCGACGCCCTGCGCGACGGCGACGACGCCTCGCCACCACAGAA
CATGAAGCGCGCCCTCATCTTCACGGCCGTCATCGCCATGGCCGTCGTGCCGCTGCCCCTGTCTCTCGGCCTGTTCGGCC
GCCAGGATGCCGTGCTCCTGCGGCGTGTCCAATCCGACGACAACGTGGCAGCCGTAAGAAGAGAGGGAGACAGCGTGCCT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62