GenePrediction:GLEAN_4796 Details

Name: GLEAN_4796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:264807..262649 (- strand)
Length: 2159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:264807..264254 (- strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_167:264171..263268 (- strand)
Length: 904
Type: CDS
Source: GLEAN
Position: GCSC_167:263110..262649 (- strand)
Length: 462
>GLEAN_4796 class=GenePrediction position=GCSC_167:264807..262649 (- strand)
ATGAGGAAGCCTGATTCCAAAAACAAGTACATCGCCATCTCACACGTCTGGAAATTTGGACATGCTGTTGAAACCGTCTG
GAACGATATGGAAGAGAAGGAGCAACTTGCAATTGACATCGACGGCCCGGACGAAAATAGCCTCGATTCCAAGATGATCA
GTTGGTCCGGCTTAGTTCAGATGGCTCATGCGGCGGCTAATATGCCCGGCAAGAAACGAGCCAGGTACATCTGGCTAGAC
CTGCTGTGTCTTGACCAAGTCTCCCAGAAAGAGGACAAAGAAAAGGAATACCAAATCTGCATCATGGGCCACATTTACAC
ATACGCGTATGCTGTCGTCACAATGATAGGTGGTGTCGCAGCTGTGCAGCATGTCAATGAGCCAACCGGCTGGATGGATA
GGGCATGGACGTTGCAGGAATCAATCCTGAATCAGACAACCTATGTCTACATCAAGTGGCCTTCGGATAAGCTGACAGTC
AAAGCCCTTGATAGCCAGGATAAACGGCGGAAATTTCAATTTCATCATGTGAAGACTGCACGAGGAGAGTTAGGGTACAG
CCTGTGTCTCATCTTGTTAAAAGATCTACTCAATCTTGCCGATTCCAAAAAAGTTTCCGGTATTCCCGAAATAAAGGTTC
TGGACGGAGAGGAAAGATGGGCCGGCGACGTTCCTCGGAGGGCTTTACGGGCTAGCCTTTCCAAAACCAAAAAAAATCAA
ATTTATCGGCGTGTGGAGGAGCATGTACATGCGGACATCGTCTAAGCCTGCGGACGTTGTGTATAGCGTCATGGCCATCT
TTAAAGTCAAAATCGACCCCTATCGCAAAAACCGAGCTCCACAATTTCTTTTTGAGGACCTGGCTCGGAAGACGGCGGCC
GACAGAAACATTGGACCGGTTTGGTTGACTCTCGGTGGCATCTATGGCAGCGAGATCTGGCAGCAGCCAGATTCGGGCCT
CATACCCAGATTCCCTCATGGGCAGAAGGCCGGCCAGAAGTCGGACAATGAGATGCCGAAGGTGGTGCACAAAGGCCGGG
TCCAATGGGCGGGACACTGGATGGACAACTCGCCATGGTACGTTAAGGAGTACAAAATGCAATTTCTGACGCACTCGCAA
CCACACCTAATCCAAGCCACGATGCTTCGGCTACGTGGCGTCTCTAAGCCCAGAAATTCTGATTTACGCAAGCGCGGCAA
CAAGACAGTGACGAGAAATGTTGGCAATATCAACATTGGCGGCATAAGGGGAGAATGCACTTACCTAGGAAGGCTGGATA
AATACAACAACACTACCCAAGCCATCTATGTCGGTGATATCGGAAAAATGCCTGACTACGGTGAGGAAACGATAGACTTT
AGGGGCCAACAGTACCTGCTATTTGTGCGCTACGACTGTAAGCAACATTCCTGGACAATACTTGCAGACGGCGCATTCAA
GGCGACATCCCGCAAGTGGAAAACTTCGCCAGGTGACAGGTACATTTTCACGATGGGCCGCGGTCCCCAGGCGTTCTATC
GGTGGCCGGTCAAAGATCTTGTCGACCCGAATAATTTAGATTTCAAAAGAAAATCTTTCGGATGCAGCTACGGTCTCCGG
TGTCTAGGAGATTTCGGGTTGGCTAGTGAAAAGGGTCAGTCAGGTCTTGAGAAGTCATTCATCAAGTAAAGAATATGCTG
ACTCGGAATATTCAAAGGGGGCCCGCCCGCCACCAGATAATTCGGTACCAGTGTGGAGAACCGCTACAGTGCACTACAAT
ATCCAGGACATGTACAAGAGGACAAGAATGTTTTCAAACACGCTTGAAAATGGCAAGAACATGACCGTCGTTTCTTACGG
GTGCACACGCTCGCCCACTTCTGCCAACAACACAATGTCTACCGTGGAGGAAGGCTGCATCAAGGTGCCGTTCAGTTATG
ACGGCTGGTCCAAGACGGTTAGCTCGAGGTTTTCCATCCATGGCGTCTGGGGACTTCTTATTCCTCACTCAAAGACAAAG
ATCGGCACACCTCAGTACGAGTATCGCATTTGGTTTGGCATATCGGGCATGTACGTGCAAATTCGGAATAACCCCTCGAC
ACCGTCCAAGTACTGGACAATGCATGCTGTGCCATATCACCATCACGAATGGAAATGTCCTAAAAAGGCCGTGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62