GenePrediction:GLEAN_4799 Details

Name: GLEAN_4799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:248660..241674 (- strand)
Length: 6987
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:248660..248611 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_167:248543..247985 (- strand)
Length: 559
Type: CDS
Source: GLEAN
Position: GCSC_167:247914..247827 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_167:247759..241674 (- strand)
Length: 6086
>GLEAN_4799 class=GenePrediction position=GCSC_167:248660..241674 (- strand)
ATGTCGATTCCAGGTTCCTCTGTCCCGGCTCTCATCTCGGCTTTCACTTTGTATGTCTCTCCTGCCCCTCTATGCCCTCA
CCTCCCCATCTCCACCCATCCGTCTCTAATCGTTCAGTGGTATTGTCGTCAATGCGGCTTCAGCTGCGCTCTTCCTCCAC
GCCAGCAGCCATGGCAACAGTATCTTTCGGGACGGCCAGAGGCTGGTCCTCGCCGTCTTTTTCTTGAGCGCCGCCCTTTG
GGCTCAAACTGACTTCATCTCCATCGCTATCAACACTACGGCCACCGGGTCCTGCCAGGTTGGAGTCATTATCAGCACCT
TCTTCGATCAGCTTGGCCGATTTTCCATCGAACAGTACCTCCTTTGGACCATCAACAATGGCGCCAAGGCGGGCGTCCAG
CAGATGATCTCCCAGGTCCTCGTCGCCATCCGATTTGTGCTTGGCGCTGTCTTCATTGGACTTTCAAGGCCTTACTTCGA
CCCCGTGTGTGTCCCGACAACCTCAGTTTTTGCAGTTGGCATCATCGTTGTCGCCCTCGATGCCTTCATTGTTGTCCTGC
TGGCTATTCGCGCCATCAATTCGAACTCGGCAACAGAGGTCCGAGCAGGTCAATCCAGCTCAGGCCGCTCCAACGCAGTG
TTGCTTGTCATTGCAACATTTGCCGTGTGGACAGCGGTCAGTGAAAGACGCCACCCTTTTGCTCGACGTCTATCGGGCTC
TGAACTAACGAGTTGCCTTGGTCTAGATGAGTGCGTTGATGCTTCTGGGCATGCAGACTACCGCCCTTTTGTTGCGTACC
TTGCTTCCATCCATCGGCCTCTTCTTCCTCGTCGGTATGTATCCATCTCCTCCCATCTTTGCCGAGCTTGTTTCGTGACA
TGTAGGCTCTAATACGCGCAGTCATTGTGGCCGCTTGCAATGCCCAATTGACCACAGAACTGATCCGAGCTCCACGATCG
CCCGAGTCGCCTGGGGTGCGCGAAGCCAACACAAGCCGGTCCATTACCACCGGAGACTCCAGTGACTACCCCCCCTCGCA
ATTCGAAGATTTTAAGCGCAACGAGATTTTGTCCGTAGCAGCCTTCGAGCGGCCACGGGAGGTTCCCAGACCAGACGCCC
CCCAAAATGCGCATGCGCGGGCTGATATCCGGCGGCCAACTCTCAGCTACCAACAGGCAGCCAGCCTTGCCTCTGGTAGA
ATTGTGATCTCGAAACCAATACTCCAGGCTAACGGCGAGCAAAACCCTTTGAACAAAATCCCCACGATGAGCCTGGAGGA
TGCTGCGAGGAGCGAGAGGGAGAGACGTGCTGACGACTTGCGGCGAGAGTCTGTTCTGGTGGCCCATCGTCCAGCACCGC
ATCCTCCGACTCTGACCCCCGAGGAAGGCATATTGCGCGCCATTAGTCTGAAGAGAAAAACAGTGGCCTCTGTGACATCC
GAACCGATGTTCGAAACGCCGACTCCGCCTTCGGGATTGATGCCCGCTGCTGTGACCACCTCGGCCCTCCTTTCTCCCGG
CGTCGAAGAGGTTCGACGACGCTCTCCGAGACAGTCACCAACGGCAGTTCAGAATATTCGCCCATCACGCCAGCTGCCTG
AGTCTTTCGGGCCTTCCAAGTCCACCTCCAGCTCCGAGTCTGAGAAGACACCTCTTCAGAAACGGCAAACATTCGGCCTG
CCGGGCAATCCCCGTGCCAAAACCATGAAGGCTCCAGCCAAGGAAGCGGATGCGCAGGGGCCACAGACGGTGCTGTTCAT
GAACAAGATCGAGTACGACAATCCGGATACGGTGGAGAGTGTTATCAAAGGCGCTAATTTGAAAATTTACGACTCGCGAG
CTTCCATGTCGGTCGTCCACCGGCCTCGGCCAATTCCGCGGAATGTTGATGACGTCCGGAACATTTTCCCATCCAATTCG
ACACCGCATATGGCTGGTCACTACCGAAGCAAGTCAGCTGGCGCTGTTGTTGTGCAGAAATCTCTTCGGTATACAGATGA
AAGTCCGCCACAACTTCCTCCGATGCCTCTGTTACCATTGGGCTTTGGAGCCTACAAAGGCGGGCAAGAGACCAATCGGC
CACTTCCCAACAACACGAAGAGCATGACATTCGACGAGAAAATGACGCTCTTGTTCCCGACCCCCCCTAGTGCGGGCGGC
TTGCCTCGTCGTCGCTCTTCGCTGCCCGAAATTCCTCAGATACCGTACGATTTCATGTCCATTACTATGTCACCAATGGC
CGAGTCCAGCCGGATGTCAGGAACCACAACCAGGACTAGAAGGACGTCCGGCAGAACGGATAATATTCTTGAGGTAGTTG
AGCTTCCACCCATGGATGCGCTGCACATCAGAGAGCGGCGCCGGCGCCTGTCTGATGAGGCCGGAGACTCGTGGTTGCCA
GGCATAGACACCGGCAACATTGTCTTGGCCATGCAGCGCGCCTTGGAGCTTGGCGAAAACAGCAGCAAACGCAGGACCAA
TATGACAAATGAGAGACGGGCATCGTCTCCAGTCCTTCCACAAATTCGCGATTCAGCATTCACGACCAGCAGTGACGGGC
GTTCCCACGACGACTTCACTACGAACTGGGGTTCGCTGCATTCGTCTGTGGTCGCTGTGCCTATCCAGGCGAACCGACAG
GTCGCTCGATCCACGTACGTGCAGGGCGACCGCCGAGACGTCGCTATGAAGATGCCTCACGCACCGTCTGTTCCAGGAGA
CTCGCCCCCATTGACAGACGAAGAGGAGAACGCGGATGCCGAACTGGTGGAAATTAAGTTGGAGGAGCCGCAAATGCCTC
GGTGGCACCACCGGATAGGCGACGACTGCCCGACATTCACAGACCGGAAGGAGAAAATCTGGTCACGAAAGATGGTGCCC
CCGACGCCCCTCATGCTCGGCGTTCCATCGACAAGGAGGCCGATAATCGTTAAGGCTGCCGAGCCATCGCCACTGGAGTC
GCCGGACCATGTTCTGGCTGAGATTCAGGCACAGCTGAAGAGATTCGAGGGGACGACGATGCCAGTCAACGAGAGCCCCA
GCCAGAGGTTTGCGCTCCTGGAAGACCTCGAAAAGGAGATGGACATGCAGGCCGGTCACTGGCGAACTATGCAGCAGGAT
ATGGGGCGCAACTCGATGTCGTCTATGCGCACGTCGAACGCTGCAGAATCTCGACGCCAGTCAATGAACAGCATTGGCGA
TTTGATGGCGTCGACGCCCGGAAAGGTCATTAGTGCTGATTATCGTGCATCCCGTCGCTCGCGGATACAGAGTGCAATTC
TCGCAGTGCCTCCCCCAATCACGGAGGAGAGAACAAGTCCGGCGGCTACCGCCACTGAAGTGTCCGGAGCCAATGCGTGG
CAGCGGAGGCTGACTGGGGCACAGGCGGAACTTCCAAGTAGCTCAACTCGTCTGAGTGGATCGCGGCGCAGCAAAAACTT
CCTAGACTTGTCTGAGCTGGGAAGCCCTACACCGCCAGACTCGGACGACTCCGATGTCGAGATTGAGCGCTACCAGCCGG
CCAGCATAGACGACACAATTGCTGCAGTGGCCGAAGCCGCAAGGAAGATTGCTGCTGCGCGCCAGCTGCTATGGACGCCG
ATGGTTGCGCGGGCCTCGACAACATTGGTGGCCACTTTGTGGACCCCCCCACTAAGCAGGTCAGATGTGTCTGCAGCTCT
GTTTGCCCAGAGTGTGAGTGGATTGGAGCAGGCCCCACACTCATCGTCTCGTCGGCGCGAAATCAGCAAGAACGCCGACG
CCGATCCGCTACTGATCGAGACGTGTGCACTCTGGAGCGAGCAGAGCGCAGCCACGGAGACGAAGGAGGCCAGTACGGGC
CTGTGGGCTGCTAAGTCATTGACCCCCACACCGGCTGCCGATGCAACGCCAGAGACGGAACAGGATGCAGCACAACTCGA
GCTGGAGCTTGATCTCATGTACATCCAGTCGCAAAACCAGTCGAAGCCACAACGGCCACTTACACAACGTCCACCAAGAC
GGAGCAGGCGGATGACCGTGCTTCCCGACATTGTAGAAAACCCCGAGCCACTTCCCAACAAGCGGGACACGCTTGGGATT
TTCCAATTCCCCTGGGGTGAAAAATCAGACATGGCCACGTTCCAGCCTCCGACTCTCATGTCCACGTTCCGGCCTCCAAC
ATTTATGGCCATGCCCGGGACCATGTCCTCGGGCGGACCGGCGATCAGCGCGGCACTCGAAGCCCGTGCCAGAGAGCTGG
AGGAGGAAGAATACTCGACGAGCTTTTTCGACGATTATGACGAGGAAGACGAGCTTGACAAGGAGGTGCAGGACCTGGAC
GATGACTCCGACTACTCCGACAGCGACGATGGCTTCGACGAGAGCACACTGTGGGAGATTGCCAGCCTGCTGAAGACACA
GCAGGTTCCGTCAAAGTTCAGCCTGCTCCCACCCCCGCTGCCGCCGATGGAGTCTCACGAGGCGGATGTGAAGGGCGAGG
ACTCCGAGGATTCCGAGGAGCGCAAAGAAACGGACTTCTTTGAGGGCACGGACGTGGCAGACGTCAGCGGGGATGTCCAG
GATTTGTCTCTCTGGAGGCGCAGTGCCGCCGAGCGGGCAGCATCAGCCAAGCAGGAGATGGGCATTTCGCAGCCAGACGA
GGCCACATGGAAGTCCTACGACAGCAACAGCCAAGCAGCAACGGCACGGGCCAAGCCCCGGCTCTCGGAACCAGCCAAGA
TTGAGACCGAGCAGCTTTGGGAGGTCCCGGCCGTGACAACAGTGGCAGTGATGCAGATTCCTTCGTTCTTGTGGACTGCC
ACTCCCAAGGCCCCCACCACTAACAAACTCTGGGCTCCGCTGCCAAGCAAGGGTCTGAAGACGGCCGGAAAGGCCATGCT
TTTCGACCTGGAAGCTTTCAAGACGCGGTCGACGACGATCCGAACCACAGATGAGGAGCCTGCCGCTCTGTATATCCCGA
GAGCACCTCGCACGCCGATACACGATGCTCTGGAGACGTTGACGTCGAACCACCTGTGGACCAGCCCGAAGAAGGCCACG
ACCACGGCCCTGCTGTGGGCTCCCGTAGCGAAGCCTGTAGTGACGGCCGCCAAGAACCTTCTGTTTGACCTGGACGTGGC
GACCATACAGAAGCTGCAGTCTACAGTCACTCGCTCGACAGACAAAGAGCCAGCAACGCTCAATGCCCCAAGGTTGCCTC
GCACAACCAGACATGCTTCTCTGGAGAAGCTGACGTCCAGCAGCCTGTGGACCACTCCCAACCGACGGGTAGCCATGCTC
TGGACTCCGATGCCGAAGGTTGTCGTGAAGGCTGAGCGCCATCTGTTCGATCTGGATGTGGAGAGAGCACTGAAGATGCG
GGCTTCCGTCCGCACTACTGACAAGGAGCCTGCTGCCCTGCACATGTCACGCAAGCCGCGGGCAGCTATTCAGACGCCTC
TGGACCAGCTTGTGTCTGACTCTTTGTGGACGGTCCCTCGGCACGATCGCATCGCCAAGACGCTGTGGGCCCCGAAGCCG
CAGATGACGACCAAGACCAAGGGCCTGCTGTTCGACCGCGAGGCCGCCATGGCTGAGAAGCACCGTGCCCACACGCGCAC
CACCGACGAAGAGCCGGCGGCGTTGAATATGCCGCGCAAGGCCAGGAAGACAAGCCGCGCACCTCTGGAGAAGCTGGCAT
CCAGCCGTCTGTGGCAGTCTGCTGTTGTCACGAAGTCGCTCTGGGTTCCCAGGCCGGCAGCCGTTGTGCAGATGAAGGGA
CACCTCTTTGATCTGGCAGCTGCTGTGGCCGAGAAGAGCCGGGCTCACACCCGGACGATGGACAAGGAGCCGGCTGCTCT
GCTGATGGCTCGCAAGGCACGCAAGGCAAGCCATGCTCCCCTGGAGACACTCCAGTCTAGCAGCCTGTGGCAGTTGGCCC
CGAAGATCCTTGCTGGCAAGCTTCTCTGGGTGCCCAAGGCAGCTGTCGTGGTCAAGGCTCAGGGACACCTGTTCAGCCTT
GCGGCTGCTGTCGCTGAAAAGAGCCGTGCTCACACCCGCACCACGGACGAGGAGCCTGCTGCTCTGCAGATGCCGCGCAA
GGCACGCAAGGTGTCTCAAGCTCCCCTGGAGATGCTAGTGTCTTCCAGCCTGTGGCAGGTGGCACCCAAGAACACCAAGG
TCCAAACTCTCTGGGTGCCCAAGCCGACGGCCGTGGCCATGACAACGAGCCAGCTGTTCGATCTGGCTGCTGCAATCGCC
GAGAAGAGCCGTGCTTACACCCGCACTACCGACGAGGAACCTGCTGCCCTGCGGATGACACGCAAGGCACGCAAGGCATC
TCCTGCCCCTCTGGAGGTGCTCGTGTCTTCCAGCCTCTGGCAGCCGGCGCCGAAGAGCCCTGTCGGCAAGCGTCTTTGGG
CCCCGAAGCCAACGGTCGTGGTCAAGACGGCGGGCCCACTGTTCGATCTGGAGGCCGTGATGGCCAAGAAGCAACACGCC
GACACGCGGACGACGGCGATGGAGTCTGTGGCAGCCCAGGTAGTGCGGATGCCACGGTCTCTGGCACAGCTGCCCGTTCT
CCCGCTGACGTCGACGAGCCTCTGGAACGTCGATGCGTCGTCTACGCAGAGCAAGGAGGCCAACTGGATCATGGCCAAAG
TCCCGACATCAATTCGCAAAACCGCTCTGGTGACGCCGAGCGAAGACTGGGACGCGGCACTGCAGGAGGCCCTGGCTGCC
AGCTACCCGCAGTCCTGGGCAGCCGAGTACGACGACAGTATCATGGCGCGGATCGAGGCCCTGGAGCATGAGCGCGAGTA
CGCAGCCATGGCTGTGCAGCAGCAGCTGGTGTCGCCGGTGTATCTGGATGCGGTGCAAGCGGAAGAGGAAGAGCCGGAGC
AGCTGTCGGAGGCGGATGTACGGTACTATGCCTACATCCAGGCGATGGAGATGGAGGCGATGATGCGGCTGCAGGCGCTG
GAGGGCGCTGGAGTGCAGCTGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62