GenePrediction:GLEAN_479 Details

Name: GLEAN_479
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:94568..99808 (+ strand)
Length: 5241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:94568..94637 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_97:94706..94830 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_97:94919..95018 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_97:95081..95196 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_97:95264..95955 (+ strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_97:96029..96364 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_97:96429..96998 (+ strand)
Length: 570
Type: CDS
Source: GLEAN
Position: GCSC_97:97515..97540 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_97:97763..97793 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_97:97885..98035 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_97:98104..98125 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_97:98254..98339 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:98401..98443 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_97:98508..99062 (+ strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_97:99117..99808 (+ strand)
Length: 692
>GLEAN_479 class=GenePrediction position=GCSC_97:94568..99808 (+ strand)
ATGAGTACAGCTGACGCCAAAGCCGTCGCGCCTGCGACCGCCGTCGAGGAAATACCTCAAGACGGAACAGGTGATTGCCC
CACCAGTTTTGTCATGAAGTTCAGGAACAGCAACTGACAGCCGGTTGTACGACGTTAGGGGTCGTCTCTGTTGATCCGTG
GCTGTCTCCGTTCAAGGATGCTTTGAGAAGACGCTATTCAAAGGCTCAGGAGTGGATAAAAACTATAAACGCAACCGAAG
GCGGCCTGGAGAAGTTCAGCAAGGTCAGCTTCCTACAAACAACTGCTGCTATTGCGCCTTGGCGACGTCGGATCGCAGCT
GACATTTGATTCCACTTTGCTATTTGTGCAGGGTTTCAATACGTTCGGTCTCAATGTAGACGGGAAGAACAACATTGTGT
ACCGCGAATGGGCCCCGAATGCCACCCAGGCTTTCCTCATCGGAGACTTTAGTAAGTTAAGCGCTCGCCTTCTTTCGCTG
AGACTTTGGCTTTGAGAATTAACACGTCTGAAGACGGTTGGAATCGCCAATCACACCCCATGAAAAAGAATGATTTTGGT
GTATTTGAGATAGTGCTGCCGGCTAAGGCCGATGGCAAGGCAGTCATTCCTCACAATTCCAAACTCAAGGTTTGCAAATC
TATATATCAAAAATATGCGAGCTTTCCAGGCCACTCCACTTACTTCTATTTTCTAGATATCTCTGGTGCTGCCAAGTGGA
GAGCAGGTGGACCGACTGCCTGCGTGGATCTCGTATGTCACGCAGGATCTTGCAGTATCTCCAGCATACGATGCTCGCTT
CTGGAACCCGCCAAAGTCGGAGCGATACGTGTTCAAGAATGCTCGACCCAAGCAGCCACCCAGTGTGCGTGTATACGAGG
CCCATGTCGGCATATCTTCGCCTGAGCAAAAAGTTGCGACGTACAAGGAGTTCACCAAGAACATGCTCCCGAGAATCAAG
TCTCTGGGGTACAACACCATCCAACTTATGGCCATCATGGAGCACGCATACTACGCCAGTTTTGGCTACCAGGTCAACAA
CTTCTTTGCCGCCAGCAGCCGTTACGGAACGCCTGAGGAACTGAAAGAGCTCATTGACACGGCACACGGCATGGGCCTTG
TCGTACTTCTCGACGTGGTCCACAGTCATGCGTCGAAGAACGTCCTCGACGGTCTCAACGAGTTTGATGGCACTGACCAC
CAGTACTTCCACAGCGGTGGGAAAGGCAGGCATGAGTTGTGGGACAGCAGACTGTTCAACTACGGCCACCATGAAGTTCT
GAGGTTTTTGCTCAGCAATCTGCGCTTCTGGATGGACGAGTACCAGTTTGACGGCTTCCGTTTCGATGGTGTCACAAGCA
TGCTCTACGTCCATCATGGCATTGGAACGTAAGCATTTCTCTTCCATTCCCCCATGTACTGCATTCGAATTTGGACTTCT
GGCTAATCGCCAACGCGGCAGTGGGTTTTCTGGAGGATATCACGAGTACTTTGGTGCCGGCGTCGATGAAGAGGCCACCG
TGTACCTGATGCTGGCCAATACGATGCTCCACGATATGTATCCCGACATCATCACGGTTGCCGAAGACGTCTCTGGAATG
CCAGCACTGTGCTTGCCCATGGCCCTAGGTGGCGTCGGTTTCGACTACCGACTGGCTATGGCCATCCCGGACATGTGGAT
CAAGATTCTAAAGGAGAAGAAAGACGAGGACTGGGATGTCAGCGACATCTGCTGGACGCTGACCAACAGACGGCACGGCG
AGAAGACAATTGCCTACTGCGAAAGCCACGATCAGGCGTAAGGATGCCCCTCCCTTGTCTTTTGTGTTCATTGGGCTGTG
CTAATGCTGGACTTGTACTAGATTGGTTGGTGACAAGACACTGATGATGCACCTCTGCGACGCGGAGTTGTATACAAACA
TGTCTGTGCTCACGCCGCTGACAGCGGTGATTGACCGGGGCATGGCTCTGCATAAGCTGATCCGTCTCTTGACGCACGGG
CTGGGCGGCGAGGGCTACTTGAACTTTGAGGGCAATGAGTTCGGCCACCCAGAATGGCTTGACTTCCCGCGCGAGGGCAA
CAATAACTCGTTCTGGTACGCCAGACGGCAGCTCAACTTGACGGAGGATCCCTTGTTGAGGTATCACTTCCTAAACAACT
TTGACCGTGCGATGAACCAGCTGGAGGAGAAGTACGGCTGGCTGCATTCGTCACAGGCATACATTTCTCTCAAGCATGAG
GGAGACAAGGTGGTCGTCTTCGAAAGGGCCGGGCTGCTCTTTGTATTCAACTTCCACCCGACGTCTTCATTCGCCGACTA
CCGTGTGGGCGTGGACCAAGCCGGCACATACAGGACCGTGCTGAGCTCTGATGATAAGGAGTTTGGCGGCTTTAGCCGCG
TTGACCACGAGACGCGCTTTTTCACTACTCCGTACGTATTTCAAAATGGAGATATGGAGCTTTTACGGGAGGTCCGGAAC
GACACTAACCAGGCATAGTATGAGATGGAACGAGCGGAACAATTGGACACACCTCTACGTCCCTTGCCGAACAGCCATTG
TATGTGTCCCCTCCAAAATCTGGAACTGCAATCCCCCACAGTTTTTCGTCATCGCTCTCGCATTCTCCAATTTTTATGCA
ATTTTTCTTGCCTTGCTAACATGCCCAGGTTCTGGCTCTAGAGTCAACAATTTAGCTGAGGGAGATGGCATTAGGGGGAA
GTCGGTGAAACGGAACGGACACGTACACTACTAAAAACGTACTGGCAAGCAGAAAAATGAGATTATCTGGCGTTGAAGCT
CAGCTCCGAGTTGAGGGAGGGGTGTAAAGAGCTACTCCAGCTCCACGTGACCTGTACCTGAAGTTGGTTTTCCAAGATAC
GTTTCCCGACTGTGTTCCGAGATCACGTGCGAGCTAGGTACGGCCGAGATACCTTTACTTTGCACAGGCCGTTCTGCTTT
GCGCGCGGTACCTGTAGGTATCCGAGGCGGGGCATCGGTTATTGGGAAGCGCGGGATCGCTCGGGAGGAAGGAGGGCATT
TGTGCCTCAGGACACAGTTATTCTCGCCCAGGCAGAAATGCAAAACAAGCGCACGTAAAGTCCGTAAACTAAGAGCTCCC
GTTTTGCTTCGCATTTTTTTCCCGACCTCCTCCGCACCCTCCCTCTTCTTTCTTTCCTTCACATCCATCGCGAAGCGTTC
TGTACCATCGACAAGATGTTCAAGAGGTTAGTAGAGGCTCAAGGCCACGAAGGACGGGTGTATCCCAATCAATTGATCTG
CAAATGGGCTTCCCATTGACGAATTTTCTCTCCGCAGCGCCAGTTTCGCTCGAGCGGCTCGTGTAGCCCGTTCGTCCCTG
ACGACTCCTCGCACCATCCGGCCGGCTGCGGGCTTCACAGCACCTTCTCTGCTTCTCGGCAGCAGATATGCCAGCTCTGC
CGGCGTTGGTGATGGCAAGATTCACCAGGTACATTGTCCTCTCATCGCCCATGTACGTGGTGCCGTCGATCCGGTTGTTA
ACGATAAATCCCTCAGGTTATTGGTGCCGTCGTCGACGGTAAGGTTTTTCTTCTCCCTCATCGCCATGCCATGCGCTGGC
GCCAATGGCCGTGCATATGGTGCATATGTCGGCCACCGTGGCTTTGGTTGAATATGGTTACTGACATGGTCGTCGTCGCT
CTGCAGTCAAGTTCGACACGGAGAAGCTGCCGCCTATTCTGAACGCTCTGGAGACCCAGAACAATGGCCAGAAGCTCGTC
CTCGAGGTCGCCGTATGTGGCCCGCCCCCTCTCTCTTGTGGCAAGCGGCAGGAAAATTAACAGCAGATTTCAGCAACATC
TGGGTGAGCACACTGTGCGCTGCATCTCCATGGACGGTAAGTTTCGGCCTACACGACCCGACATTCGAGGCTGTATCGCT
CATACGGGTCTTTCCTGCAGGTACCGAGGGTCTTGTCCGTGGCGCCAAGGCGACGGATACCGGCTCGCCTATCATGATCC
CGGTCGGTCCTGCTACGCTTGGCCGTATCATGAACGTCACGGGTGACCCGATTGACGAGCGCGGCCCGATCAAGACGGAC
ATGCGCCGGTCGATTCACGCAGAGGCACCTGCTTTCACTGAGCAGTCGACGACTGCCGAGATTCTCGTTACGGGCATCAA
GGTTGTCGACCTGCTGGCGCCGTACGCCCGTGGTGGCAAGATTGGTCTCTTCGGCGGTGCCGGTGTCGGCAAGACTGTGT
TCATCCAGGAGCTTATCAACAACATCGCCAAGGCGCACGGTGGTTACTCTGTGTTCACGGGTGTGGGCGAGCGGACGCGT
GAGGGTAACGATCTGTACCACGAAATGCAGGAGACGTCTGTGATTCAGCTGGACGGCGACTCCAAGGTGGCGCTTGTCTT
TGGCCAGATGAACGAGCCCCCCGGAGCTCGTGCCCGTGTGGCCCTGACTGGTCTGACGGTGGCCGAGTACTTCCGTGACG
AGGAGGGCCAGGATGGTGAGTTGGACCTTGTGTGATTTTGGCTTTGGTTTCGACGTCTAACCGGGACAGTGCTTCTCTTC
ATCGACAACATTTTCCGCTTCACGCAGGCTGGTTCCGAGGTGTCTGCCCTTCTGGGCCGTATTCCCTCTGCTGTCGGTTA
CCAGCCCACGCTGGCCGTCGACATGGGTCTGATGCAGGAGCGTATTACGACGACGACCAAGGGCTCGATTACGTCTGTGC
AGGCTGTGTACGTGCCGGCTGACGATCTGACGGATCCGGCTCCGGCGACGACGTTTGCCCACTTGGACGCGACGACGGTG
CTGTCACGTGGTATTTCCGAGCTGGGTATCTACCCCGCTGTGGACCCTCTGGACTCCAAGTCGCGTATGCTGGACCCGCG
TATCGTGGGTGACGACCACTACAACACGGCGACGCGGGTGCAGCAGATTCTACAGGAGTACAAGTCGCTGCAGGACATCA
TTGCGATTCTGGGCATGGACGAGCTGTCTGAGGCGGACAAGCTGACGGTGGAGCGTGCGCGCAAGATCCAGCGTTTCCTG
AGCCAGCCGTTCACGGTGGCGCAGGTGTTCACGGGCATTGAGGGCAAGCTGGTCGACCTGAAGGACACGATTGCGTCGTT
CAAGTCGATTCTGGCCGGCGAGGGCGACGACCTGCCGGAGGGTGCCTTCTACATGGTGGGCGACCTTGCCTCTGCCCGTG
TCAAGGGCGAGAAGATCCTGGCCGATCTGGAGGAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62