GenePrediction:GLEAN_4801 Details

Name: GLEAN_4801
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:235175..233023 (- strand)
Length: 2153
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:235175..235012 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_167:234939..233200 (- strand)
Length: 1740
Type: CDS
Source: GLEAN
Position: GCSC_167:233140..233023 (- strand)
Length: 118
>GLEAN_4801 class=GenePrediction position=GCSC_167:235175..233023 (- strand)
ATGGCCGCTTACAATCCCATGTCGGCGCTCTCGGCGACAGCGGGCACCAGCGCCGACAGCGCCGATGGCCTGGGACTCGG
CGTCAACGTGAGCCATGCAGGTGGCGCGGGCAGCCTAAGCCTGGAAGGATTCGATCGCGACATTGGCTTTGATGACGTGC
TGCTGTATGTCGATCGGACCTGCCCTTTTCTCTCTTCTCTCTTCTCTCCCTACAAAACACCACTCTGACAAGTCAGCGAA
AACGTCGGACTGGCACCGCTGCCCTTTACGCCGACGTACGACTTTGAGACGTTTTCCAACACGTTTGAGGACCCGTTCCA
TTACTCGGCCGGTCCGGCTGGACGGCCCTACGAGCTCGCCCAGCTCGACACTGACGGCGGTTTTCACGAGTCCATCTCGC
CGCAAGATGAGGGCCTCGACAACAAGCTGCTCGGCTTCTCGGATCCGATCGTCAAGGCCGCCGTCCTCGACGACGCCGGC
CAGTTCGCCGATCCCGCCATGACGGCTGAGCTGTTTGGCATGTTCTTCCTGGCCGAGGACGTCTACGCGGCGGAGAACAC
CGGTCGGCCGCTCGAGCTGACCTGCTACCGCCGCAATCTCTGGTGGTGCTCCGGCCAGATCACGCTGCCACGCCAGATCA
CCCACGCCGTCACCGCCGATCAGGGCCGCCACCTGGCCGTGCTCGAGCTGGCTGTCTCCATCACTGCCATCGAGAGCATC
GAGGGCAAGCCGACCGAGATCATCTGCATCCCCTGGAAAAGCACCACCGCCACCGGGACGGCCACCACCGCTACCGCTTC
CGCTGTCGCTACCGCCCAACACGAAGACACCAAGGCGGCCGGCTCGCCGCCCAACCTGACCATCGACCTCGCCAACGGCC
AGGAGCTCGAGAACGGGCGCGTGTCGGTGCCCATCTCGTGGAAGCGCCTACAGTTCAAGCATGCTACCGCCAACAACGGC
CGCCGCAAGGGCCAGCAGCAGCACTACGTCGTGCAGATCAACCTGCTGGCACGGGTCAAGCCCGAAAGTGCTGCTGGAAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTAGTAACGGCAGCAACAAGAGTGGCGCGAAAACTGCCGCTGCCTCTTCTG
GCAACGATGGCCAAGATGGCTGGCTGAAGATTGCCGAGATCCAATCTGGCCCGGTCATCGTGCGAGGTCGAAGCCCACGG
AACTTTGTCAGCCGTCGCGATGTGCCTTTGACAGGCAGCGCTGGCATCGGTGGGACCGCCGTCGCGGACAAGAAGCAGCA
GCAGCAGCAAAGCTTCCAGCGATACAGCGCACTCAGCAGCGTGCAGCCGGGTGACTGGGCTCACGGCTTTGCCCAGCAGA
GCCCCCATCCGGCCAAGAAGATGAGCCTGTCGCCCAGTCTGCCGCGACCGCCGGTGCCTTCATGGGACACGCCGTCCCGG
ATGCCGTCCAAGATGCTGCCACAACAACAGCCGCAGCAGCATCAACAACAACAACAACAACAACAACAACAACAACAACA
ACACCAGCAACATCAACACCACCAAATCCAGCACAAGCAGCTGCAACATATGCAGCCACACCAGCTGCAACATATGCAGC
CACACCAGCTGCAGCAACATCCACCCCTCTACCAACAGTCACAACCACCACCACCGAAGAAGAGAGCAAACAGCACGGCT
CTCCCGCTCAGCCTCTCACTGTCGGAAGATGAGCGCAGTCCCAACCGCCTGAGCACCGATCCGCTGCCCAACAGCCCGCC
GTTCCCCCATCTGGGTGGCGCCGGCAACATGTCGGCCGGCAGCGCCCTGCCCGGAAAGTCATCAGCGGCCGGTGCCAAGA
CGGCCGGCAGCAACAACGGCAACAACAGCAGCAGAAGCAGCAGCATGGCCAACAACACCGTTGCGGCATCGGGCGAGAAC
CCGTTTGAGGACGACGACCTGCTGTACGAGTACTTCCCGCTGAGTCTTGATGATTGGTAAGCATGAGTATCTCTGCGCAC
AATGACAACAGGACAACAGAACTGACAGACACTAGGATGCCGCCCGTCGACGCCGTCTATCGGCCGCACGTTGTGCACCA
CACAGTTGTGCCGCCCGAGGTCAAGGCACAGCAGGTGCGCAACAAGACGAAACGGTATTTTGCCGCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62