GenePrediction:GLEAN_4803 Details

Name: GLEAN_4803
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:221167..218750 (- strand)
Length: 2418
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:221167..221123 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_167:221055..219014 (- strand)
Length: 2042
Type: CDS
Source: GLEAN
Position: GCSC_167:218951..218750 (- strand)
Length: 202
>GLEAN_4803 class=GenePrediction position=GCSC_167:221167..218750 (- strand)
ATGGCCCAGGATACTGGCCACTGGAGCGTGAGGCGCACTCGAGAGGTGCGACTACGCAGGGTTCCTTCCGCCCCTCTCGT
GCCTTTTGCTGACCAGATCGTCGTGCACGCAGACCCTCGGTGGCCTCACCCTGAACTCGGCCATCCCCCAGCCGCCGTCC
GCAATGAAGCGGTCAAACTCTTCCGTCGGCCAGGGCGGCGCTCCCTTCTCGGCCAACCATGCGCGATCAGTCTCGGGATC
ACGGCACTCTCTTGCGCCCACGAGGCCGAGCCAGCCGCTGTTCCAGCGCTCTTCGACCGGCGCCAATCTAGTCGACCTGG
GCCTCACATCGGCCAAGCGCTCGTCCATCCGCCCGTTCACACCAGGTGTGCCCGGACGGGCATCGATTGCAAACGACCGG
CGAAGCAGCGTCTACCAGGGCGGACGGCAGTCGATTATGGGCGGCGGGATGGGTGGCGGGATGGGTGGCGGGATGGGCGG
CATCACAGCGATGGGCGGCAGCCACCAGAGCTTCTTCTCCCAAGCACCAGCACCAGCAGGAGCAGTGCGCGATCCACGAC
CTCTCCGGGACCGCTCCTACTTGGCGCGGATTGGCCAGGAGCTGATAGAGTACATGACGCAGCACAACTTTGAGCTCGAG
ATGAGCCATACACTCTCACAGAACGTGCTCAAGTCGCCCACACAAAAGGACTTTGTCTACATGTTTCAGTGGCTATATCG
ACGCATCGATCCCAATTACAAATTCCATAAAAGCATTGATCAGGAGGTGCCCGTCCTGATGAAACAGCTCCGCTACCCGT
ACGAGAAGGGCATCACCAAGAGCCAGATTGCCGCCGTTGGCGGCCAGAACTGGGGAACGTTCCTCGGGATGCTGCACTGG
ATGATGCAGCTGGCCGTGATGCTGGAGCGATACTCGGTCAATCGCTACGACGATGCGTGCGCAGAGGTCGGTGTTGATGT
GGTGGCCGATCACATCACCTTCGACTTCTTGGCACATGCATACCAGGACTGGCTGGTCATGGATGTCGACGAGGACGCAG
CAGACGACGCGGACCAGCTGGCCAAGATGATGGCGCCACACATCGAATCGATGACCAGGGCGTTGGACCAGGCCTACGCG
AAGAATGAGGAGGAGCTGGCCATTCTGGAAGCAGAGAATGCCAAGCTGCTCAAGGACATCGAAGAGCTGGAAAAGTCGAC
GCCCGATTTGGCCGTGCTAGACGACCACTTCAAGATCATGGAGGAGGACAAAGTGAAGTTTGAAGAGTACAACGAGCTCG
CACTGCAGCGCTGCGAAAAGTACGAGAAGCGCATCCCGCTGCTGCAAGAAGAGCTGGACAAGCTAAACGAGGAGGTCAAG
GAGGCCGAGAACGAGCAGCGCAGCCTGCGTCAGGCCGTGGATGACCAGGGCATCAGCATGGCGGATATCGACCGCATGAC
ATCGGAGCGTGAACGGCTGCAGAAGGGCATCGAGGCGGCGGGACAGCGGCTGGAAGAGGCGAAGAAGCGGGTGTCGGACC
GCGAGATGGATGCCAGCCAGCGACTGGACGAGCTGGAACGCATGGTGGACAAATACAACACGCTGGCCTACCAGATTGGC
CTGATCCCAGCCACGGCAGCCAACGCCAAGGGCAAAGACTACGAGCTGCACGTCAAGGTGAACGACGGGCCCAGCTTCAC
GGCATCGCAAATGGGGCCGGGCTCCGGGCCCGGGTCGCTGTCGGCGGCGCTGGGTGACGCTGGTGGCAGCAGCATGGAGA
GCGAGCGGCTGCTGGCCGACCCGGTGACGGGTTACCAGCCGGCACACATCCTCAACCTGGACCTGCGAGGCACGGTTAAG
AACAGCTTCCAGGCCCTGCGCAAGGACATTGCCGAGCGGCGCAACACGGCGATCGAGACAATGATGAAGGACCACGATCT
GCTCGACAACATCAAGGAAGCCATGGAGGACAAGCGCAACGAGGTGGAGGCGCTGGAGCACCGCGTGCGCGCAGCTGAGC
AGGAGCACGAGAAGACCAAGGAGGTCACGACGGCACAGCGGCTGGCCTCGGACGCACAGATCGAGAAGATGGAAAAGGAG
CTGGCCAAGATGCGCGCGAACCTGACCGAGTCGGTGCAGCTGATGGAGCAGCGCGAGATGAACACGAACATTGAGTGAGT
GATTGGACAGATTGCGGATGCACGGATGCATGGGAGCCGGACTAACAAGGAGCCAGATACGAGCAGCTCACCCTACGAGC
CAGTGCTCTGCGCGAGGAGCTGCACACCGAGATCATGCGGATGCTCAATGATGTGATCAAATTCAAGATGCACATGCAGA
AGAGCCTGGAAGAATACGAGGAGTTTGTGACCGAGGAGCTGGTCAAGGAGCTGGGCCCCGAAGACGGAAAGGACGAGATG
ACGGGACTGGATATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62