GenePrediction:GLEAN_4805 Details

Name: GLEAN_4805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:214272..212907 (- strand)
Length: 1366
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:214272..214192 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:214109..213505 (- strand)
Length: 605
Type: CDS
Source: GLEAN
Position: GCSC_167:213387..213326 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_167:213268..213187 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:213127..213097 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_167:212951..212907 (- strand)
Length: 45
>GLEAN_4805 class=GenePrediction position=GCSC_167:214272..212907 (- strand)
ATGGAAATCATCATCGTCGGCGCCGGGATTACCGGCCTCAGTGCTGGGATTGCTCTGCGTACAGCAGGACACACAGTGAC
GGTTCGTCCAGAATGTCTCAGTGCTGCCGATACTAACATCAAGGTCTAGATCGACGTATGCCACGTTCTGACATGTGCAC
TAGATCCTCGAGCAGTCCTCCCTGCTCCAAGAGACCGGAGCCGCCATTTCGATAGCACCGAATGCAACACCTGTCCTCCG
CAGCTGGGGTTTCGACCTTGCCAAGTCGCGTATGGTCGGCATCAAGACAGGAAGCATCCTCAATGGCAGCAATATGCAAA
TGGTAGTACCCAAGTACTATGAGAATATTGAAAACAATTACGGCTTTCCCATCTACTCAGTACACCGCGTCGATCTGCAT
GACCAACTGAAATCACTGGCAGTAGGAGAGGCCGGGCCAGGTCAACCGTGCAAGTTACATGTTCGTGCCGCTGTGGTTGA
TTACGTAAGCTGCGCCTCTAACGAGTCCACACTCTCTCCGGCCCTTGCTGAGAAGGTACATAAGGATGCTGTTCATGCAA
AAGTCACTACTGCCGATGGTACAGTCTGGCGGGCAGACATGCTTGTTGCGGCGAATGGCGTGCACTCGACGGCCCGAGAA
CATGTCTCCATCTCGGACGAGATTCCTGCTAGTGACACGGGCTGGGCTACTATGCGATGGCTGGCTCCGACGGGGTCATT
GCTGTCAGACCCAGATACTGCATATTTGGTCGAAGAATTTACGCAGAGGTACTTCGTGGGTGCTCGAGGCGGGGGGTTGG
TATGGTATCCGTGTAGGAAGTGCGTCCGAAACCTCTGCTTTTGATCCAGTGATTATTTGCTAAGTTGTGACCTTTCCGTT
TACAGCAACGAAGTACAGAACCTCTTCTATCTCTCACAGTCGTTTGAAAGTGAGAGTATCACAGAAGGTATGCACACTCG
ACTCATGTGACGACTAATACTTTGCCAACATGAACGTGTTGTAGACTTCCAAGCAGGTATAGAGCCGAGCATGGTGATGG
ACTATGCAAAGAAGGAGTTTAGTGTGGCTCTACAAACTGTTCTTGTGTGAGTTTCGAGTCACAGGAAACCTGGCTACTGA
AGCGTTTGACTAACACCCCAGTCAGGAAAGCCAGGGACGTCAAATTCTGGAAACTGGTTGCCAGACGCCCAATGCCTTCG
CGGCAAAAAAAATCGCTTCTTCTGGTTGGAGATGCTGCTCATCCCATGCTTCCTTGTATGCCTTGCTTCCAAAATGCATG
CGTTAGATCGAGTCGGTATTGCTTCTGACATTGATTAACAGTCCAAGCCCAAGGCGGTGGTAAAGCCATCGAGGATACTG
CAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62