GenePrediction:GLEAN_4806 Details

Name: GLEAN_4806
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:206572..203988 (- strand)
Length: 2585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:206572..205336 (- strand)
Length: 1237
Type: CDS
Source: GLEAN
Position: GCSC_167:205268..205188 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:205126..205048 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_167:204594..203988 (- strand)
Length: 607
>GLEAN_4806 class=GenePrediction position=GCSC_167:206572..203988 (- strand)
ATGGCTTCTACTCCGCTGTATGTGGATTCCGGTGGCGACGTTGCCGAGCTGATGGGCGAAGGTGCGCGTCTGAAGAAGGC
CGCCCGCACGCTCAGCCTAACATTTGCAACCTCCCCCGACAGTCCACTCGATGGTTCGCTGCACCCATCGCTACAGGCCG
TCAAGGTCGCTGTATCTGCCCCCCTCAGAACACTAACACGCCGTTTGACACAACCGCTGGCTCCGAAGGACGAACAGCAA
ACGATTACCGATAAGCAAGTCTCCACCGAGGAGCGTCTCTTCAAAGAGGCCATGAAAGAGTACGAGAGCACGGCCAAGCC
AAAGTACCGCACCGGCATCGACCCAGAAGCCACGCACACTTTCAAGGAGCTTGAATCAGTGCTGGCCGATGCGCTGAAGA
CGTCCCAGCCGACCGGCGGGGCTTGGGGTCGCATAGAGAAGGCGTTTCAGAAGCTGGGCGAGAGCAAAGAAAATCTGGAC
AGCTGGCTGGGACTGCTGCCGAGCGAGTCTGAATACTTTTCAATCGTGTGTGGTGGGCTGAAGATGGTCGTTTCGGTAAG
CCGCCCATTTGTATACTGCGGCGAATTGCATCTTCCATCTGGATCTTCGGTGCTGACAATGAAGGCGGCTGCTCGCATGA
GCCATGTCAAGGACGCCGTCATGGAGGCGTTGCTGCAGATTCCCTTCCTTCTCAACAGCGCACAGCGCGTGCTCGCGATC
TACGACAAGAAACCGACTCTTATAGCCCTGAGCAAATCCTTTTACGTCTCTATCCTGACGGCAATCGGCCACATCCTCCA
TTATCTACGACAGAAATCTGCCAAGAAGGTACTGAAAGCCATCGTAACACCGACTTCGTTCGAAAAGGGGCTTCTCGCAA
AGGTCCAGGCCATAACCACGGCACGAGACGCCTTCAACGCCGAGGCAGATATCTGCCAGAAGGAGACGCTGGACGAGCTG
GCCAAGGCCACGGCTGCCGGAAACGCACGGATTCTCGATACACTCCACGCTGTCATAGTGGCTGCCAATAAGGAATACAG
CCGCGTGTTGCAGGTGCTGCAACATAGCTACAACGCCATTGAGCAGAACCTGTTTCAGATCAAGGACCACCTTGTCGACG
TTAGGGAGACGCAGAACCGACAGGCTATCGCCTTAGACGAGCAGACCGAAGCAATGAAACATTTGATGGAGTTTATGACA
GGAAATGCACAAGTGCTACGAACTGTCGAGGCCCTAAGTGAGCGTTCCTGTGTTTGCGTATTAAAATAGCGCAACGCTCC
GGAAGCTGACGAAAACATATACAGATGCCCCATTGAATGATCTAGCTGGGGCCGACATTCGCACATTTCGGCTGGCTCTA
CTGGCACCCAAGGCGGACAAAGAGGGTAGGTGCTTTTAGTATGAAATTGGCACAAACAACAAGACGTTGACTGACATTTG
GACCAGAACGCGTTGCTGCATGCAAGACACTTCTCCGAAGACTCGACTACGACCTCGCTGCTACCAGTGCCGACCTTCTG
GATATGTATAAGATAGGCCCAACGATTGTGGCTTCTACTCCGTGCACCACTAGTCTGTCACGCACGTTCTGCGTGATCAC
CAGTGTAAGACCCGTACGGTAACCCTTGTGGGATATTCGTCCGGACCAGTTGCACGTATCGTAGTAAGCTCTAAGGCCTT
CAGAAGATCTAGTGATGGTATTTCGTTCGGTGGTTGACTGATTGAAGACCAGACTGTGCGCAGTATGCGCGCAGATCAGG
GCTTCGTCTTATCTAGTAATTTCGGCGGCCGAGGTCAAGTCAGGTGACCTCGGGGAAATCCACACGATGAACCGCGATGA
TCAGGAGCGGAGTGTTCACGTGACTCGGTCAGAGCAGTTGGCTGCGTGGGTGTCTGCGCCACACTCAACGGCACTGCTGG
TGAACGGAGGCAGCCAAGCAGCAATGCGCTGCTCGGCAATGTCGTTTGTGTGCGCAAGAATGGCAGCAGCACTGCTGCAC
ATGCGCTCGCAGGCCAAACCCGATGTCGTGCCGCTGTACTACTTCTGCGGCCAGCACATTGCCAGCGGCAGCCGAGGCGG
TTACCAGGATATGGTCAGCGGCGTGGCAAATAGCCTGCTAGCACAGCTAGTGACAATCTGTGGCGAAACGGATGAGGAGG
CCGGCGTGGACGTCCGGCCGGCCATCGCCCTGGGAAAGGTCAAGCACGATGATGTGAAGTCGGTGCTGCGTCGTTTTCGT
GCTGTAGTTCTGCAGCTTCCTGCAGATACGATCGTTTTCTGCATCGTCGACGGCCTCTCTCTCTATCTGGGCGCGCAGAG
GACTGAGGCTGCGGCCGAGCAACTGCTGCATGGGCTGCTTCGCCTGTCACGTGACAGCAAGTCGCGCAAGTCAAAACCGA
CCTGCACCTTCAAGTTGCTGGTGACAGCCCCATACCGGTTTAACCCTCATGTGGCGAGCGAGATCGCAGAAGAGGAGGAG
ACGTTGAACGTTCCCTTGCGGCTTCCTCTGTCCGGGGGCTTCAACGAGATGAAGTGGCATCTGAGCATAGGACAGTTGCT
GGACGAGACATCTGAGTCTGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62