GenePrediction:GLEAN_4808 Details

Name: GLEAN_4808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:185836..182970 (- strand)
Length: 2867
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:185836..185506 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_167:184980..184826 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_167:184270..184004 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_167:183942..183842 (- strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_167:183357..182970 (- strand)
Length: 388
>GLEAN_4808 class=GenePrediction position=GCSC_167:185836..182970 (- strand)
ATGACTCTCTCACCGCGCGATGCTATCCAAATTGACGAATTGGATCGCTATGACACGTTTATGGCCACGCTCGGTGACAC
GCAGTTCCTAGACATGTACCTCACCGAGGCCAACGTCGTGCAGATTGACGTGTACGAGATTTCGGCGACCGAGAGCCCGG
CGCACTCTGCCACCTTCGTTCCAAGCGAATACGCCAGTCAGTACTTCGACCAACAAGCCCAGCGAGCTGCGGAGATTCTC
GAGACACCGACTGATGCGGACCTCGGCAAGCGCATAAATACTTGTGAACGCAAACAACCTGAGGCGACGGCGGCTCCAGA
TATACCACTGGGTGAGGATGTGTCGCGGTGCAATCAGTTCTGTGGGACCATTGCTCACTGCCGGGGTAACAACAGATGCC
CGCATTGCTATGCGGTCCGGCAAGGGTGTTTGTGGCAGAAATGGTGTCGCTAAGCATCGCTCGCATAGTCTCTTATCTCG
GCTGTTGAGATAAATTTGTGTCCTCCAAGAGTTACGTGCTGGAAGATCTCGTGATGTTCTTCGGGATCATAATAGTAGCA
TCTCGAAGAAGAATTATTGCCACCCATTACGAAAAACCTCACTTTTCCCACCCTTCACGGCGCCCTCCAATACCATTCAG
ATTCCTGTTATGCCGTCTGCTACGTGTATATAAGGAGGCCACTATGCCCCTTAGTGGGTATTGTTTTTTTCGATCCTTAG
TTCAGTTCAATACATCCTCATGACAGAGATAGGCAGCCGCCTTCTGCTCCCGACGCTTTTGTGGCCCCACTGGGATTAAA
AAATCGGCCTACATCGCGATCACGCATGATTTGGTATCCCTCTTTTGACGATGGAGCTGCGCAGACGCCTGTCATGTCCT
TTGAGAGGCGTGTGGTCAAGATAGCCGACTCACTGGTCACTGCTCTCGGCTCGCACGTCGACTCTCGTCTGCCGCTCAAC
GGCAACAATTTCGAATTAAACGCATCAGCAACAGATCCCTACGGCTACCCTGTACCGAGCCTATAAATGCCTCAAAGACA
CCGGCATAGTGTTCCGCAGCCGCCATGCCTGTTGACCGTCGGCCATTGGCCTCTTCGCAGCCACGGCTGCTAGCTGTAGA
AAGAGCATTGCCAAACTGGTCTCTTCAGCTCCAAAGATAGAGGCACTCGTCTTCCGTACAGGCATGTTGGTTCAGGTCAA
GACCGCAGCTACCGTGGCAGCCAATGCGGCCAAATCTATCACAAAGAGGCATCATTCGGTAGCGTCGTAGCGGATACCGA
CCCGGTCGCAGTATTGTCCACGCACGAGGCATAATTCTACATTGTGACTGATTTGCCGGGGCGTGTTTGAAAGGGTTGTG
CACGCAATGCACACCTGTACACTGAGAGGGACTCACAGGATCTGGTGCAAAGAATCAGCAGCGCGGAAAACTCTTAGCCT
GCTCGTCTATGTGTCATCTCCAGCCAGACCTTGGCAGCGACGTCTGCTGCAGACCTGTTGATGGCTGTTGGAGACGTCCC
GACACAGACGCTATGGTGGCCCTAGACCGCGGACACTGCCATCTAGGCTCTTGCATTGTATAACGAGGCAGTCGTCTTTC
CTTTTGCAGTCGTCCGGGTTCCACGCTGTGAGAATGGCTGCTTCCTCAAGCACGTGGTCGGCTTTGACGCGTGGTTCTTT
GGGTTGTGGCTGTGCGAGGCCGAGCAAACGGACCCGGCGCATCAGCTGGCCCTCCTGACGGCCTACGAGGCCATGGAGAT
GGGGTCTATGGTGACGGATGTGTGGCCGTGTGCTGGCGTTGAGAATAATGACGTCGCCGGTACGCGAGAGGAAGTGCGCC
CGGTTGTTGGGATTAGTCAGCACATTCATTTGGCTGGCCAGCGATATGTCGCAGTCGCTGCGACGCCGTCACCACCTCGG
CACCCACAATGTCATCATTAGCCGCGTGCTGGCCGCTGTCAAATTCTATCGCAACGACGTCAGCTACGTCGAGATGTACG
GCACCGGAAAAGAAGCCGACAACGCCTGAGAGATGGATGGCGTGCTCGGCATCGTTGCCCCTGCCTCGGCCCCGGCTCCA
TCTTCCGGTCCGTCTTCTCGTATAGCCTTAGGAAGCAGCCCGATCTCCCGGCTAGACACAAGGGTAACAGCGGCTCCGCT
GAGTCGGCTTTGGACGCTGTCTTACATTGGTGCGCCACAACCTGATTCCGCCTCACATCAGCATCACAATTCGCATCAAC
AGTAAGTTTCCCTCGGACCTGCACCAGCGAGATGTCCTCGGGAGGCACCTACCCTGCTGGTTCTATACATGAACTTCAAT
GACAATACCTCTTTTGCACCGACGTCGAGCCTCACAAACGTCCACAGCGGCCACCTCGATGCCGACTTAGAGCTCCCCTC
CCATTCCTCCAGCCAGTTCGGTGCTTCTGCAAGAAAGCCCAATCGGACAATACAAAACTCTGTGGCTCTTACCGAACAGC
TTAGGCGTGACCGTATCGTACTTGACGCTGCAGGACCTCGACCTGCCTGTTACCGTCTACGGCCTGAGCAGCCCGTTTAC
CATGAGTGTCCGCGTGCCGCGGGATCTCTGCATGATCCAGCGGTTCTTTGCCGAGCTCCAAGATCGAAGCTTGGCCGAGC
TTCGTCATCGTCAGCACCACGGGACGTGCTACCTGCGTGGATGGTTTACCGACGGGATCTGCGCCCAAGGCATTTTCCAG
GATCCCGTGGCAGCCGGTGTGGAGGCTGAGAGGGTCGTGCTGAACGACAGTCCCAGCCCGGTCAGCTTAGCCAAGTTGTT
CATGCACCTGTTGCCGACTTCTCTCGGCTCGGCGTCTTCGGCTCTGATGCTGCCTCAACCGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62