GenePrediction:GLEAN_480 Details

Name: GLEAN_480
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:99816..102420 (+ strand)
Length: 2605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:99816..99857 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:100028..100147 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:100819..100905 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:100972..101406 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_97:101467..101853 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_97:101911..102420 (+ strand)
Length: 510
>GLEAN_480 class=GenePrediction position=GCSC_97:99816..102420 (+ strand)
ATGAGAGGGACCACCAAAAACGGAGTCAAGTCGCCATTTAGCGTGTGTCTGTGTAGTAGTTTGTATAGAGGGGAGCTCTA
GTTCCGGGGAGGCTTAGGACGAAATAAGTATCCGTTGTGAGCTGTGTACAAGAATCTATTCCTTCTCTTTGCGCAGATGT
GTACGATGAGCAACAACTTGTGTCAGCGTGCTCCTACGAACATTGTCTCTAGATCTTCCAAACCTACTGGCTTGCCCGTG
TCTATCTGGACCCAGCGGCCGTCGTAGAAGACGACGTGGCCGAGGGCGACGAGCATCGCGAGCAGCCGGTTGAGAATATG
GCTGGCCGAGGCGTCGAGACTGAGGGGCGGGCGGCCGGATAACGTCGACGATGAGGCCGATGCCACGCCAGACGACGATC
CAGTCTAGGTTAGCCGGCTGGAAGAGGAGCTCGCAGCAGAGGATAGGGCTGTTTAGATGTAGGATCACAGGGTTCTGCAG
CTCTGACCTGGAGACCCTATTCTCCAGCTGGTCAGCTCCTTCCCTCCTCCCACTCACCCCGTACACACATCTCTCGTGCC
GCAGCCTGCAGGCCTGACATCACGGCTGGGCCTCACCGCACTTGACCTTGCGCAGCTTACAGCCGGCATGGCCACCGCGC
GACTTTCTGTGTGGCCGCTTGGTGTGATAAGGCTTCTTGGCCGCACCATCTCCTGCTGACGATGGCTGGCCCTCGCCGTC
ACCCTGCATCGTCCACGGTGCCGAACCTCCTGCGGTAGACATCTCGGCTTGGTAGATCTGTCACCCCCAAGCGTTAAAAT
GCACTTCGTCAGCAGCCGGCGACTGTAAGAGTAAGACGGGCAGATCCGGACGAGACCCACGTTGCCTGTCGATCACGTGA
CATCACAATAGCTTTTGGACGCGTCGCGTTCCACTATATTGCAGCATACTCCGTACTGCGTACACGACAGCATCCAGCAC
CAGGACCAGCACCACGACGATGACTTGCAGCGGTCTATTCCAGGCGCCCGACGGGTCTTCCTGCGCGGACCTGGTGCAGA
CGTACCCGTGCCGCGAGCAGCAGATCCGGACGCTGGCCACGCTTCTCGACGTGAGTGGAAGGAAAGGCCTGCCCGCCTCT
GTCTTGTGCTGATCGCTGACCGGACCGGACGTCCAGCCGGCCGCCGCGCCATGTGGAAACATCGTCGTGCACGGCACCGA
GGCGACCGGCAAGAGCGTCGTGACGGCGGCCGTGCTGCGGCAGCTGGCAGCGGCTGGCCGTCGGGGCGAAGGAGCGAGTG
ACGACGGGGACGACGGGGATGAAGTGCGGCACCGGCGCATCGGCTATGCCGTCGTCCACGCGACCGAGTGTGTCACCAGC
CGCCATCTGTTTGAGCGCACGGTGGCGCGTACGGCAGAGGCACTGCGCTGGCAGGCGCCCGTGGCCCGGCGCTGCGAGAC
GCTCGCCCAGCTGGCCGTCGAGCTGTCCAAGATGCTTCGGTACGCCGACTATCCGGCCGGCTGGCGCTTCGTCCTCGTCC
TCGACGCCATCGACCGTCAGCGCGAGGCACCGGCCACCCTGCTGGCCGGTCTGGCGCGTCTCTCCGAGATGGTGTGTGCA
TCTATCATCTCGAGTCGTTCCGCTCCCTTCTCTCATATGCTGACTAATCAGATCCCTCGTCTCACCACCGTCTTCATCGT
CACCTTTCCGGCCCCGTCGCTGTTGCGCGCCAGCTTTGTCCCCCACGTCCACTTCCACAACTACACCAAGCCCGAGTTTG
TCGAGCTGCTCGGCCGCACCCCGCCACCGCCGCTCGCCAACGCATCGCCGCAGGACACCGCCGACCTCTGGCTGCGCTTC
TGCGGCGCCGTCCACGACGCCCTCACCCGCACCGCCGGCCGCACCCTGCCGGCTTTTTCCGAGGCCTGCGCCGCCCTGTG
GCCACGGTTCAGCGCACCCGTGGCCGCCGGCACCCACGGCGCGCGCGAGTTCTCCAAGCTGTTGATTGCTGCGCGCATCC
ACTTTCAGGACGAGTCGATTGTCGATCCTGGGCTAGTGGTGAGAGGTAGAGGAGGAGCAACAACAACAGCAGCTATATCC
ATCTCCACCACCCAGCCCTCCACCCGTGACCTCTCCTCCCTCCTCCCCACCACGGCCAAGCTCTTCCTCCTGTGTGCCTA
CCTGGCCTCACACAACAGCGCCAAGCACGACCTGACACTCTTTTCGACCTTTAACCACGGCCGCAAGCGGCGGCGTGGTG
GTGGCTTCGCCGGCAGCCGCCAGGGTCCCCGCACTAAGCACCGCAAGATTGCGCGCAAGCTGCTGGGCGCCCACGCCTTT
GGGCTGGAGCGCATGCTGGCCATCTTTGCGGCCGTACGCAGCGAGTGGACCCGGGCGCCGCCACTGGCTGCCGCTGGCCG
CAACTCGGCTGCTGCCATCGTCGACGGCGACGTCGGCATGGCCATTGCCACGCTGGCCAGCCTGCGGCTGCTGCTGCGTG
TTGGCGGTGCCGGAAACGACCCCATGGACCGTGCCGGAAAATGGCGCGTCAATGTAGGCTGGGAGGTTGTGCGCAGCCTC
GGGCGCAGCATGGGCATCGAGATGGAGGACTGGCTGGTCGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62