GenePrediction:GLEAN_4810 Details

Name: GLEAN_4810
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:172960..171429 (- strand)
Length: 1532
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:172960..172811 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_167:172713..172586 (- strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_167:172211..172122 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_167:172063..171715 (- strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_167:171662..171429 (- strand)
Length: 234
>GLEAN_4810 class=GenePrediction position=GCSC_167:172960..171429 (- strand)
ATGGCAGAAGCCAAAAAGACGTTAGGGCAACCTTCATCTGCCACTAGCCCTGTGGTCCCCACTCCTGCACCGGAAGGTTC
TGTATTGCCAACCTCGGAAGACGTCGAGGTTTACCCCGGCCACTATTGGACTGCCCAGCCGTGGGACGATGTGAGACTTG
CTCTGATTGCCCCAACTTCGACGCTGTCCTCGCAAGAACGTGGGCATCTATGGTCGCGTGTGTACGGTTGCCTAATATGT
TGCATAGGACAATGACTCGGCGCAAGGCGATGATGCGGCTACCTCTACCTCTTCCATCACATCATCTATCCTGAGATACC
GGACAGTCAACGGCCGGACATATCACAGCGATAGCATCGCAACCAACAAGTACTGGTAAGCTTTGAGAACAGCAGTGCCG
ACATCGATATGCACTAACTTGAATCAAGGGGTGCAAATGACGCGAATCAGCAAAATGCACTGGACATCTAGTACGCCTAA
AGCTATCCTACTTCTGTGGCCTTTTTTATTAATATCTAGCCACCATGCGTTCTTGCTGATGTTGGACGGAAAACTCCATC
TCGCTCCCTTGCCAGACAACATAGAGGTGAGTTGTCCACTGTATCTTGTTCTTGCATATATATGGCTAACGTACAATCAA
GCGCGTACTGGACATTGGAACTGGAACGGGAGTATGGGCTATGTAAGGAAGCCCATCAACAATCTCCAAGTGTAAACGTA
CGTCAATAACGGCTGACACGGTGGCTTAGTGACTTTGCCGACTTACACCCTGACGCCACGGTAACCGGTACCGATTTATC
TCCTATTCAGCCCTCATGGGTCCCGCCGAACGTTAGCTTGTATGAGCAGTGCCTTGATTCTGGCTTTTATTGCGGCGCAT
GGCTGATAAATGCATAGCGAGATCGAAGATTTTACCCAGCCGTGGACATTTGCGCGAGAGTCAATCGACTTTATCTACGG
ACGTTGGTTGATAGGCTCCGTAACGGACTGGACGGCCTTATTTAAGAATGCCTTCGAAGCATTGAAGCCAGGTGGCTGGT
TCGAAACCTTTGACTTCAATGGCTTCTTTGAGTCTGATGATGGTTCCTTGACCGACAAGGCTGCTGCCAGCCAGTGGGGT
TACATCTTTCGAGAGGGTGCAAAGAAGCTTGGCTCAACGGCCTCTTTCACGATAATTAGCGATAATGTGCAGCAGAAAGG
CCTCAAAGAGGCGGGCTTCATTAACATTCAAGAGCACCCAATGAAGGTTTGCAATTCTTTTTCCGTTGCTCTGATTTACT
TGACTGACAACTTGCTAGGTCCCTTGCTCCGAATGGCCAGAAGACCCAAAGCTGAAAGAAGTTGGCTTGTTTATTCGAGC
TGCCTGGGAAAACGATCCTGAGGGTTTCATGGGCTTCATGGCGAGTACGATTGGTTGGTCACCAGAAGAAATTACTGTCT
ATTGCGCTCACATGCGTCGCGAGCTACGCAGCCTGAAGATCCGTCTTTACTACAAATGTAATGTTGTCTGGGCCCAGAAA
CCATACTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62