GenePrediction:GLEAN_4814 Details

Name: GLEAN_4814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:155608..153537 (- strand)
Length: 2072
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:155608..155480 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_167:155424..155409 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_167:155357..155131 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_167:155060..153537 (- strand)
Length: 1524
>GLEAN_4814 class=GenePrediction position=GCSC_167:155608..153537 (- strand)
ATGACCTCGTTACTGCGCGGCCTTATTTTGGCCTCTGCTGTCATCCAGTCCGCCCAGGCAGTCACCTTGTCTGTTTCGAC
CAGTGGTGGCAATGCATCCAGTCCGCTGCTCTGGGGATACATGTTTGAGGTGAGAACGACAAGTTGTTTCTGCTGCCTTC
TTCTGCTAATCTAACCTCGACAAGGACATCAATAATTCCGGTACGTTTGAAGTATCACGGTCTGTCGTTTTTGGTTGTTA
ACAAGTAACAGGTGACGGAGGCATTCACGGACAGGTGCTGAAGAATAACGGGTTTCAGCCTGGATACGACACAACACTCA
CTGCGTACGCAGCTGTGGGCGGCAGTACTCTGTCAATTGACACTGCCAACCCGCTCTCTACGGCGATTACTAGCACGCTG
AAGGTTACCAACCCGTCCTCTCATTCGGGTACTGTTGGTTTCTCAAACTCGGGCTACAACGGTGTTCCCGTGGATAGAGT
TCGTTTTTGATTCCTTGCTCTCGGCAGTCACACCTCCGTACGGTGACACCATTCTTACTGTAAAATAGGGCACATACAAG
ACGCTTGTCTGGATCAAGGGAACGTACTCCGGCCAGGTCACAGTGTCTTTGGTATCCAATTCTACCGGAACTGTCTTCGG
ATCGGTGGCATTTTCGGTCAAGTCCACATCTTCAGAGTACACCTACTATGACGTGGACCTTCCAGTCACCCAATCTTCTG
TTGCCCTAGACAATGTCTGGAGGCTGACTTACGATGCATCTGCTGCTACCGATGGCCACTTGAACTTCGCCTTGCCCCAG
CTCTTTCCTGAGACATACAAGGGCCGGGCCAATGGCCTCCGGAATGATGTGGCCACGTTCCTAGACGCTATTGGCGGCTC
GTTTCTCCGGTGGCCTGGCGGCAATAATCTCGAGGGAAACACAATTGCGACAAGATGGATCTGGAATGAAACCATTGGAC
CGGTGCAGAACCGGCCTGGTCACCTCGGCACGTGGAGTTACATCAATACGGATGCCCTTGGTCTGATGGAATACCTGTAC
TGGGCGGAGGATATGGGCATAGCGAACGTTCTGGCTGTTTGGGCCGGTCACGCCTTAGATGGGACGGTGGTCACGGGAAG
TCAACTCGCCCCATACGTTGACGACATTCTGGACGAGCTCGAGTTCGTTCTGGGCGACTCTTCGACTCCATTTGGAGCAC
TCCGAGCGTCGTACGGCCGGGAAGAGCCGTTCAAGGTGGACATGATTGAGGTCGGCAACGAAGACAACCTTTCCAAAGGA
TGCAGCAGCTATGCATCAAGGTTCACACAGATCTATAACGCCATACATGCAGCCTACCCTGATATCACCGTTATTGCCTC
AACGACGGACCAAAACTGCCTGCCCACCACCCTGCCCTCCGGTGTCTGGACGGATATTCACTACTATCTCGAGCCAAACC
AGTTTGTGGCAAGGTTCAACGAGTTTGACAACTGGTCGCGAACCTGGCCCATCTTTGTCGGGGAGTATGCCAGCACGACC
GGCAATGATGGCTCCACAACGTACTGGAGCAACCTGGTCGGCTCTTGCTCAGAGGCAGTGTACATGATTGGCCTGGAGCG
CAACTCGGATATTGTCAAGATGGCCAGCTTTGCACCACTGCTTGAGCACTTTGACCTCGCCGAGTGGAGCCCTGATCTGT
TTGGGTTGGACTCGTCTTCTGGCTCGCTTACCGGATCCACATCTTATTACGTCCAGCAGCTCTTTGCATCTAACCGAGGT
ACGACGATTAAGCCAGTGACATCCGACTCCGCCTTTGGGCCGGTGTACTGGGTCGCGTCATCCACAAATACGGGAACGTA
CTATGTCAAGCTCGCCAACTATGGCACCACCACACAGTCGGTCACAGTCAAGGTCCCAGGCGCTTCTTTCGGGTCGGCCA
GCCTGCTGTTGCTGAGCGGTAACCCAACCGCCAGCAACTATCCCCATGACGTGACAATAACCCCGACAAAATCAACCCTT
TCTGGAAGTGCAAGCGGTGGCTATACTTTTAGCCTTCCGGAATATGCCGTTGCAGTCGTAGTTCTTGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62