GenePrediction:GLEAN_4815 Details

Name: GLEAN_4815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:146566..144350 (- strand)
Length: 2217
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:146566..146322 (- strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_167:146258..146235 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_167:146139..145884 (- strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_167:145824..145659 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_167:145578..144653 (- strand)
Length: 926
Type: CDS
Source: GLEAN
Position: GCSC_167:144582..144485 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_167:144425..144350 (- strand)
Length: 76
>GLEAN_4815 class=GenePrediction position=GCSC_167:146566..144350 (- strand)
ATGGATTTCACAGACGCACTAAAGGAAATGATCCGACGGGTGCCCGCGAACGAGCGGGCCGACGTGTTCGCTGCAACGGA
GACGCCGATCGGCGCAGCTGCTGCTGCCGCTGAGAATGATGGCGGCGAGAAGGGCCTGGCTAAGGCGACAACTGCGGCTG
TGGCCGAGGCCGAAGCAGGCGTGTCTAATATCGCGGCGACACAGTCAGTCTGGGGAAAGAAAGGCTTCTATCTGGTGTGT
ATAGGGTATGTTTCCGGAAAGAGCATGTATGTATGCGATGGTGTTCCGGAAGGCTGACCTGACTCCAGACTGGCCATGAT
TATGACCTTGTTGTAAGTTTTTGCTTCGTTGGATCTCAGCAATGATCTCTTCGGCACTCTGCTGACAACTACAGCGAGCT
TGATAACTCGACTGTCTCTACCTATAGCAATTACTCGACCTCAGACTTCAACAACCTCTCGGCCCTGGGTACCCTCAACA
CAGCCACAGTCATCATTTTCGCCGTGGCCAAGCCACCCATCGCCAAGATCTCCAACGTCATCGGTCGTGGCCAGACTTTG
GCTATGACCGTGTGCTTCTATCTTCTCGCCTATATCCTCATGGCATCAGCCAAGTCGATTGGGCCGTACGCCGGCGGCAT
GGTGTTTTACAACATTGGCCAGTCGGGTATGAATGTAATGACGGTGGGTTCTCTCCCAATTAGGCACGCAGCTGAGAAAC
AGCCACTCACTCACTATACCAGCACATCATCGTTGCTGATATCACCAGTCCACGCTGGCGGTCCTTTGGCCTTGCCATCT
GCTACTTCCCCTTCCTCATCACGCCTTGGGTATCGGCCCTGATTGTAAACAGTGTCGTGTCTGACGGAGGCATCGGTTGG
CGCTGGGGAATTGGCATGTTTGCGTTTCGTGCGTATCTTCTTCACGACCATTGCATATGACCGTCCCGTTTGTTCTTCTT
GTCTGTCTCGATCATCTAACTCATTCAGTCATGCCCTTTGGCGCCAGCTTCATCATCGGCACTCTCCTGTGGTATCAGCG
AAAAGCGCGCAAGCTCGGCATCCTACATACGCAAACGATTACATTATACGGCTTCTGCTCTGAGATCGACCTCGGCGGCA
TGTTGCTCTTCATTGCTGGCTTTGCCTGCTTCCTCCTACCGCTGACCATTGCGGCCCAGGAAAAGAACGGCTGGAGGACC
GGCTGGATCATTGCGCTCATCATCATTGGTGCCTTTCTGCTGATCTGTCTGCCCTATTACGAGACGTACTACTCGCGTCA
CCCCATCATCCCCATGTTCTACCTTAAGAACGCCACCATCATTTTGTCCTGTTTGCTGGTCATGACCGACAGTATCGGCT
TCAGTGCCACCCACACATACCTCTATGACTGGGGTGCTGTGGCCCATAATTTCCGTCCTACTGTCGATACCTATTATGTC
TACACTAACGGCGTCATCCAAAGCCTCGTCGGCATCTTTGCTGGACTTTACATGTACTGGGCCCGTCGCTACAAGTGGCT
CATCATGTCTGGCACTGTTCTTCGCCTCATCGGCTACGGTGTCATGATTCGCCTGCGAGGTGCCCACAACTCCCTGGCCG
AGCTCTTCATTGTCCAAGTCATTCAAGGTGCCGGCAGCGGCATCATCCAGACCGCCCCCTTGGTTGCGCCCCAGCTGGTC
ATCCCCCACAGCCAAGTCGCACAAATGATCGCCGTCGTGTGGACCTTTTCCTATCTCGGCAGCAGTTTGGGCTCCACCAT
CGCCGGCGCTATCTACACTAACACGATGCGGGAGCGTCTGATCGCGCGCCTGGGCAGCGATGCCTCGTCTGCTCTGGTTG
ATTCCCTGTACAACTCCATCACTGGGACGCTACCAACATGGGGGTCGGCCGATCGGATTGCAATCAACCTTGCTGTGAGC
TTCCCGGTCTTGCTTTTCTTCTTTCCTTCTTTTCTGTTTCTCAGCTGACAGCAGTCACAAACAGTACTCCGACGTCATCC
GATACATTACATACTCGGCCCTCGGGATGTCCATCCCGGCAATCATCTTTACCTGGTTCCTACCGAATCTTGAAATTCCA
GAGTAGGTCTGCACTTCCATTGTGAGTTCTAGACATGTCACTAACTTGTCAGGGACACCAGTGTTCTCATGGGTGGAGTA
GACGGGCAGCATGCCGAGGACTCACCATCAGAGGAACGCAGAACTTTGAGGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62