GenePrediction:GLEAN_4816 Details

Name: GLEAN_4816
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:143720..141327 (- strand)
Length: 2394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:143720..142808 (- strand)
Length: 913
Type: CDS
Source: GLEAN
Position: GCSC_167:142748..142687 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_167:142632..142511 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_167:142446..141565 (- strand)
Length: 882
Type: CDS
Source: GLEAN
Position: GCSC_167:141497..141398 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_167:141332..141327 (- strand)
Length: 6
>GLEAN_4816 class=GenePrediction position=GCSC_167:143720..141327 (- strand)
ATGCCAAGGCTGCCGGCGATGGCCCCCGAGAGTCGACTAAACGGCGCTGACGGACGGTCTACTAGCACCCCTGTTTCTGT
GTCTGCGTCCGATCTTCGCCGAGTTCTCCGCGATCGACAAAAAGCGCGAAATCGCATCTCGTGTCTTCCGTGTCGAGAAC
GCAAAGTGCGGTGTAATCGCGAGCACCCGTGCCTGACATGCATCAAACGCGACCATGCGGACCTGTGCATCTACACCGAC
GCGCCATTTCCGGCACGCTTGAGCAGTGTACAGCCTGTTCCTGCAGTCTCAACCACGCCGCCAGCTTCGCTAGCTTCAAC
TGCCTTTCGCCACGCAGAACCTCCCAACCGACAGTCGCCCTCGTTGGACCACCAACAGAGGCCCTTGGATGGTGCTTACG
CACAACCAACGCAGGACTCCCCGTCTTCGTCCTCGGGGATGCCACTTTTGGGTGGCGGCTCGCTGCTGGCCATTGCGCGA
GAGCACGACTCGGAGACGAATGGCGTCGATGACGATGCTGGTCGAGGGGACGTATTGGAGAATGCCGTCATGCCGTTGCT
GGGAGTTCCCGGAATGGACAACAACAGCCGCCCGGGGACCTCGTTGCAAGGCGACGACCTGTACGCCGACTTGCCCCGAG
ACCGAGAACTGCTGGACCTGTTTTCCATCTACCGGACTAGAGTGCATCCTTTCCAGCTTATCCTCGCCGACATCGAAGCG
GTCGAGAGCGAGCTGTGCGCGATCATCAACCGGCGAGCCAGAAGCAGAGGCCTGTCTGGCGCGGATGCGCAGAACGCTGC
GACAGTACCGGTCCGGCGCCAGTTTTTGTGCCTCGTGCACGCTATTCTGGCGACGAGTGGGCAGTTCTCGGACCTTTCCG
CCAGCGACCGGAGCAACATCTCACGACGACACGGTATGTGCGGGCTTCTGTCTTTGATTCCCTGTTGCTGACACGCAAGT
GGCTACGGACAGTACGGTGTGCCTTTCAGATGCTCATGGCCGAAAACTACTTGCTCCAGCCGTTTCACGAGGGCGTAAGT
GCCTTAGTCATCCTGGCTCACGTCCTACAGAACGATGGCAATCCCCAGGCGGCTTGGATCTTGAGCGGTAGTACGATCCG
CATGGCCATTTCCCTGGGCATCCATGCAGCAAGTAGCTGCCCAAAACTAGGGCCACCGCCGGTGCCAGCTGAGACGGCAC
GGAGCATCCGGTAAGAAAGGGCAAGGCCAAGTATTTCATTACGAGATGATCTTGCTCACAAGTGTTATTCTTAGGTTGGC
CATTGTATGGCAGGATGCGCTTCTCTCGTTGGCCTTCAACCGGCCACCGGCATCGCATGATATGGACTCGGTGCAGGATC
TCCCAGTCCTCGACCAGCGAATGGATGATGGCCCCATGGGACTGAGCTATGGACATGCTATGAACTGGCTGTGCCACCTT
ACGCTCAAGCACTGGCAGTACGCGGTAAGCCGGCCAGGAGACCGAGCTATGGACCGGTACACGAACCTCTTCAGCGACAT
GGACGCCTTGGAAGGCGCTCTTCAGGACCATCTTCGCAGCCGAGACGCCTGCCATTCGATCCAGGCCATCCAGGAGCTTT
ACAGCTTCGAGGTGAACATGAACTTTACCATCTCGACCTTTTGCCGCCCGATTCTATCAAAAGACGGGCTTCAGGGCCTC
ACCAAGGCCGAGGCAGAACTGGTCCTAGCTCGTTTGCAAGATTCACTGAAGCGCAGTGTCAAGGCCTTTATTCGGACAAG
GTCTGTGACGGGATATGCCAGCCGATCGTGGGCCTTTGTGCACAACGGCCTGACGTCGGCGCTGCTGCTGAGCTTTGTGA
AGGAGACGCGAAATGAGGATGAGTCGAGACAGATCCAGGACGAACTCATCAAGAGTCTGGCAGAGGGCGACGGGATCCTG
GCGTCGGAATCTGGCGCGTCATCCGGGGGCGACTGTGCAAGACAGATGACGATTGCACACAGAAAGTCGCTCAAGGCCTT
GAAGGCGCTGCGGAAAATATCCGAAGAGGAGCGCCAGCGGACAGTCCGACCAGGCCTGCGAGGCCAGCCGGACACGGAGA
CCGGGGAAGACCCGATGGATTGTCCTGAGAATCTTGCTTTTGCCGGAAATGCAATGGGCATGTATCAAGACCCTGGGTCA
GTAGAGTATGCCTGCCCCCCTGAGACAGCAGAGAGAATGTGCCAGGCTGACAAGCTGGGTTAGAACAATTGAGTTTGACG
AGCTTCTGCGCTCATTCGACTTTGGCTCTGCATTGCCCATAGAGGCGTTTGACTACATCACTTTTGATCCAATGGCACCC
AGCGTGAGTTGTGGGAGAAATGTTTTTGAATTGTCCCCGTTGAATCATATGACTAATGCTTATGCTAGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62