GenePrediction:GLEAN_4818 Details

Name: GLEAN_4818
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:135221..134675 (- strand)
Length: 547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:135221..135066 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_167:135007..134867 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_167:134806..134675 (- strand)
Length: 132
>GLEAN_4818 class=GenePrediction position=GCSC_167:135221..134675 (- strand)
ATGGACGCAGGGACCGCAACATCGCTTCCGCCCGAGGCCGTGGCGCTAGCAGCACGCATGTATGACGGCGCACGGACTGG
TGACCTCGCGCTCTTTACGCAATCTCTGCCGGCTGGTCTGCCGGCCAATCTAACAAATGAGAAGGGGGATACACTGGTAC
GCGGGCCGTTATTGTGGTTTCGGCACAAAGATAGGAAACGTACTAACCGCCCAGCTTATGCTTGCCGCATACCACGGACA
CGTCGATCTGGTGCGCTTGTTACTTCAGCATGGTGCCGACCCAAACCGGCTTAACGATAAAGGCCAGAGCCCACTGGCAG
GCGCTGTTTTTAAGGGTGAAGATGCGGTTGTCACAGTAAGTTTAAGTTTTTTTTTTCTCTTGGGTCGGATCCCGAGGCTG
ACTGCAATCGTACAGGCGCTTCTAGAGGGCGGTGCTGACCCGGATCATGGCACGCCTACAGCCCTCGAGGGCATCGTTCT
TTTTCGGCAGGAGGAAAAGTGGAAGGCTCTGTTTGAGGCAGCTCCTGGACGAGGAAAAGCTAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62