GenePrediction:GLEAN_4819 Details

Name: GLEAN_4819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:132663..130710 (- strand)
Length: 1954
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:132663..132307 (- strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_167:132254..132151 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_167:132096..131605 (- strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_167:131526..130710 (- strand)
Length: 817
>GLEAN_4819 class=GenePrediction position=GCSC_167:132663..130710 (- strand)
ATGTCTGCTGCCATGGAGCCTCTCCAGCGAAAGACGACAGTGACGGTCGTGCCGGAAACACAGGCCAGCCAGGACATCCC
TCCCGAGGACGGCAAGGATGGGCGCAGTGACTTGGCCAAGACGTTGTCCAAGACAGCCATGGCAGAAGCCATTGTGCGCA
TCCGCACAACGCCCTTTGACCCCGAGAAGGATGTGCCGTCGTCGGTGGCTAGCCCGGCCTCGACGCTCTTCCTGCCGGCA
GAAGAAGGGCCCGAGCCGGCTGCAGAGACTGGCCCAACAGCCACTTCCATGCCTGCTTTGAGCGTTCAACGCCAGCTCGC
CATCACCGGCTGCATCATCATGAGCAGCTTTGTTCAGGTGCGCAGCTTTACGCTTCTCGCCAAGCAGATGTCAGACTGAC
CGATTCCAGTACATGTCCAACTTCCTCACACTGGGTGCCGGCTACTGGTTTGCCGATAAGCTAGTGGGCGATGCCAGTCC
GGCCGGCTCCATCTGGATGGTCTCTGCTTACTCGTGAGTCTTTTGACCGGCTATAGCTGGAGAGCTTCGTACTGACGCCC
CCTTCAGCCTCACCCAAAGCAGCGTCGTCCTTATCGGCGGCCGTCTTGGCACCATCTACGGCCACCAGCGTCTCTTGCTC
GCCGGTCTCGCCCTCATGACCATCATGTCCCTCGCCAACGGCTTCTGTACCCACTACATTGCCTTTGTCATTGTGCGCGC
CTTCACCGGTCTTGGCGGTGGCCTGCTGATGCCCAACGCCGTTGCCCTCATCGCCGTCACTGTGCCGCCTGGCCGCAACC
GCAACATCTCCATGGGCTTTTTCGGTGCTGCTGCTCCGGTGGGCGGTTGGATCGGCGGCCTGGTTGCTGGCCTGTTCATC
CGCTACAGCACTTGGCCCTGGCTGTTCTACTTCATGGCCATCGTGACCTTTGCTGTCTTCTCCGCCCTCGTCCTGCTGCT
TCCCAAAAACGAGGAGATCTTTGATGAGGGCGGGAAGATCGACTATATCGGTGCTGTTCTCGGCCTCGGCGGCCTTGCTG
TTTTCAATATTGTCTGGACGTATGTTTATCTTATCTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTCCTCGCTCTGCTCG
TGTTCTAACCGTCCCAGACAAGCCCCGTCTGTCGGATGGCAGCAGGCCAGCGAGATCGTCCTGCTAATCCTCTCCGTCGC
CCTCTTCGCCGGCTTCATCCTGTGGGAACACCGCTTTGCCTCCGATCCCATCATGCCTCTCTCCATCTTCCGCGCGCCCA
CCTTCTCGGCCCTCATCTGTGTCAACCTGCTGACATACATGTCTTTCGGCATCTCGCTGTGGTACCTTATCGCTTGGCAG
CAGCTTATCCGCGGCCTCTCTGTCCTCGACTTTGTCGTCCACTGGCTGCCGTTTTGTCTTTCAGCCCTCGCTGCCGTCGG
CATTGCCGCCTTTCTCATCCCTCGCCTGGCTGCCCAGTACATCATGGCCATCGGAATCGTTGCCGTCATGGCGTCGAACC
TGCTGCTGGCCACCATGCCTGTCCGCCAGTCGTACTGGGCCCAGACCTTTGTTGGCACTCTTTTGAGTGGCGTCTGCCCC
GACTTTGTCTACGTTGCCGCCCAAATAATTGCGAGCAACAGCGTCAGCCGCCACCAACAGGGACTCGCTGGTAGCCTCAT
CGGCACTCTCAACCTCTACGGCAACAGCCTTGGCCTCGGCCCTGCTGGCACTATCCAGTCTCAGGTGGCTAAGCACTCGG
GCGATCTCGCCAGCTACCGTGCCGCTCTCTACTTTGGTGTCGGCCTGGCCGCCATTGCGCTCGTTGTGGATCTCGCCTAT
GTCCGCATGCCTCGTGACCGTCGCGAGGGCTGGTCTGACTCCGATAAGGAGGTCCTGCGGGACGCTGCTGCTGCTGCTGC
TGCCTCGGCGCCAGCTTCAGATACCCGCGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62