GenePrediction:GLEAN_481 Details

Name: GLEAN_481
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:105033..106821 (+ strand)
Length: 1789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:105033..105455 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_97:105520..106821 (+ strand)
Length: 1302
>GLEAN_481 class=GenePrediction position=GCSC_97:105033..106821 (+ strand)
ATGCCTCATGCAACCACAACCGGCACCGGCCTCCAAGACCCGCAGACGAAGCACGAACCTGACTACCGGCCATCCACGAC
CGAGAAGATGAGTTCGGTCGCGGCCAGCAATGGCTTGGAGAAGTTTCCCGACCTCGATGTCCAGGAGCTCAACGCCCGCA
TCCCAAGCCCCCAAGGCCCCAACGGCCAGCCTGGTGGACTCTCATCGCAGCTTGCAGGTCAATGGCAGCCCTGGAAGGAC
CCTCTCGCCGACGCTCCTCGGCGTGGGAATTCGTTTGGACAGCCCAACCGCGCATACGGCCACAGCAGACAGAAAAGCCT
CGGCGAAGCTCTTCGCACAATCCGGACTCGTTCCGGTAGCACCACCCAGAACGTCCATGAGATTGCCGATGCTCTGAAGG
CGCCGATATCACCAAAACTCGTGGTATGTGCAACCTACCCGCAGATCGGGCTATGTTCTCTGGCTGACCCAGCTTCCTTT
TCGCTAGCTTCTTTGTGTTATGTGGTACTCCTCGTCTGCCTTGACCAACACGTCGTCAAAGTCCATCCTCAACGCCTTTG
ACAAGCCTGCCACCCTGACGCTCGTTCAGTTTGCCTTCGTGTCATTCTATTGCATCCTGCTGGCCTGGCTGGCCACCGTT
TTCCCCTCCCTAAAGCGCCTCCTCCCAGTCCTGAAATACGGCATCCGCTCCCCCACAGCCGAGGTCCTTCGGACTACCCT
GCCCCTAGCTGCTTTCCAGATTGGTGGCCACCTTCTCAGCTCAACAGCGACGTCCAAGATTCCCGTTTCTCTTGTCCACA
CCATCAAGGGCCTGTCTCCGCTCTTCACCGTGTTCGCTTACCGATTGTTCTTCGATATCCGCTATCCAACCACCACCTAT
CTGTCCCTCATTCCGTTGACCCTCGGTGTCATGCTTGCGTGCTCCGGCAGTCATTCTTTCAATGGCGGTCAGTTTTTCGG
CCTCTTATACGCCCTATTGGCCACCATGATCTTTGTCACCCAAAACATCTTCTCAAAGCGACTCTTCAATGAGGCCTCGC
GCGCCGAAGTCGAAGGACAGGGCATAAAGGGCCGCAAGCTGGACAAGCTGAACCTGCTTTGCTACTCTTCGGGGCTGGCT
TTTATGGCCACTGTGCCCATCTGGCTCTGGTCCGACGGCTTCCACATTTTGGGCGACTTTCTCCATGACGGCTCCGTCGA
CCTGAGTGAGGGTCCCAACAGCTTCGATCACGGACGGCTGCTGGTCGAGTTCATTTTCAATGGGACCTTTCACTTTGCGC
AAAACATGCTGGCGTTTATTCTGCTCTCTCTCGTGTCGCCAGTCACTTACTCGGTGGCGAGTCTTATCAAGCGCGTTTTT
GTCATTGCCATTGCCATCTTTTGGTTCCGGAGCCCGACGACCAAAATTCAGGCTGTTGGTATTGCCCTTACTTTCATGGG
ATTGTACTTCTACGACCGTACCAACGAAAACAAGGCAGACCGCCGAGCCCGGACCATGACCGAGGTGAACGCCCAGAATC
TGCTGCCCCTCAACCTCAACGCCTCTTTGCCGCTTAACCAGAATACGGCACACATTTTTGAGAGCCCTTCGGCCTTGTCA
GCCGCATCAGGAACGGCCCATCCTTACACAGTCGGATACAGCGTTGCTACCATCGATGATCCTAAAAAGTCCGACGATGG
CGGTCGGGGCCGGGCACACGGAAGCAGCAGTGCTACATGGATGCCTCCTGGGACACGCCAAGAAGACACTTGGCGTACGG
GCGACAAATATCAGGTCCCGGTCTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62