GenePrediction:GLEAN_4820 Details

Name: GLEAN_4820
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:129768..128793 (- strand)
Length: 976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:129768..129520 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_167:129437..128793 (- strand)
Length: 645
>GLEAN_4820 class=GenePrediction position=GCSC_167:129768..128793 (- strand)
ATGTTCCCCCCTACTGAAAGCAAAAGAGAATGCAGGCGTAAGAAGGACGCTGAGCGCTGGCCTTTCTGTTCCGATGCCTT
CATGATTGGGCCCCCTAGCTGTACACTGAACGATCTGCGCAGACCGCGACTGCGGAAGTGCCCATTCGACATCGGCAGTA
CCACCTGGATCAAGCCTCTTGGAGGTGGTCTTGACGGCTATTGCTGGAAAGTAATGTTTGGGAATGAGGGGCCATATGTG
ATCAAGCTTGTAGGCACTCGTACGCCCGATTGCACCACCGGGTCCTTTCCTTTCCTGTCTTTCTTTCAAGCAAGTCTCTA
ACCAAGTACAGTTCTGGGACAGGGAGCAAAGATCTAGAGCTAGCTTTGCCTCGAAGCTTGAATGCCGCAACGCCGCGCTT
CTCCAGATGATGCAAACTGCGGTCGAGGATGGAAAGGCGGTGGGCATGCCCGTTTTGCTGAACCACAGAGCCAGAGCCTG
GGTCGAAGCCATTCAGAACATTGAATCCTTCTCGGTTGAAGAACGCCAAGACTCCGAGGCCCGCATCAAGAGGGCAGCAG
AACTGGACATTAAACTACGCCCTTTTCTGTCCGTTCCACGCCTACGCAAATGCTACGGCTGGTTGTCTATCTCTGGCGAG
ATCCTTGCTGGATTACCTCAGCAACTTCGCCCACCGGACGCTGAGATCAAGTGCAGAAGCACAAGATGGCCGAACTGGGC
CGAAGGCCCCGATACAGATTACATGGCCATCGTATACGAGTACGTGGAGGAGGCCCCCAATAGCCCAGCCGCAGTCCAGG
AAGTGGTGGATTTTCTCCATCTCGCCGGCTTTACCAACACGTTGTCTCCCTGGACACGCAACTGGCAAGGCAGTGTGCTC
CTGGATATATTGGCCATCGCTTCTCCGTACGAATGGGCTTGGCGTACCGATAATTATATAAGGCTCATCAAAGCGGAATG
GATGCTGAGGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62