GenePrediction:GLEAN_4822 Details

Name: GLEAN_4822
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:111863..111075 (- strand)
Length: 789
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:111863..111631 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_167:111567..111075 (- strand)
Length: 493
>GLEAN_4822 class=GenePrediction position=GCSC_167:111863..111075 (- strand)
ATGTCTGGCATTTCTCGTCTTCTTGAGGCCACCACGGTCCTGCTCGCTGCTGGCGCCGCCGTTGCCAACCCCATCGAAGC
TCGTGGCACCATCAACCACGATGCGGTCGTTGGCTTCTCCCAGACCGTTCCTGGTGGCGTCACCGGCAGCGTCTACCTGG
CGTACCAGCCGCTTCTCAAGGTCGTCAATGGCTGCGTGCCCTTCCCGGCTGTCGATGCCTCGGGCAACACTGGGTAAGTC
TGGACGAGGAGGAGATGCAAAGAAATCAACCTGCTAACACTGTTTCCTTCTCTTAGTGGTGGTCTTCAGGACACGGGTGC
CAGTGAAGGCCACTGCTCCAAGAGCACCGGTCAGATCTACGTGCGCAAGGGCGAGCTGAACGGCAAGACTGCGCTCATGT
ACTCCTGGTACTTCCCCAAGGACGAGCCGTCTGACGGCATTGGCCACCGTCACGACTGGGAGGGCACCATTGTCTGGCTC
AAGAGCGGCACGAGCACGGCGGCCAACAACATCGCGGCCGTCTGCCCGTCTGCCCACGGCGGATGGAAGTGCGCCACGAG
CGGCTACAACCTGCAGGGCTCCAAGCCGCTCATCAAGTACGAGAGTGCCTGGCCCCTGGACCACTCTTGCGGCCTGACCA
ACGTGGTCGGTGGCAGCCAGCCTCTGATTGCCTGGGAGAGCCTGCCCAACGTGGCCCGTGTCGCTCTCACGAACACGGAC
TTCGGCAAGGCCAACGTTCCCTTCAAGGATGCCAACTTCAACAGCAACCTCGCCAAGGCCACCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62