GenePrediction:GLEAN_4823 Details

Name: GLEAN_4823
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:78362..76355 (- strand)
Length: 2008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:78362..78130 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_167:78053..77901 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_167:77769..76871 (- strand)
Length: 899
Type: CDS
Source: GLEAN
Position: GCSC_167:76797..76355 (- strand)
Length: 443
>GLEAN_4823 class=GenePrediction position=GCSC_167:78362..76355 (- strand)
ATGCCGTCCACAATCGAGGCCCTCCAGCTGTTGGGAGAGCGGGCCATCTCGACCAGCATCCATGCGGTCAAGAAGAAGAA
GAAGCCGGATTGGAACCTGAAACTTGCCAGGTATTTCGCAGCTGGCATCTGTGGCATCATTGCTGTCTTTGTCATTCTGC
ACTGGACACGGATCATCTACAAGAAGCTGGGTAGCAAGGGGCGTGTCTTCTCGCCAATTGTGGCTATTACACGGTAAGTA
GGGGAGAAGAAGGAAGAACGAGGGAAGAAAGACGAGAGGAGACAAAAAACAGAAAAGCTGACAAAACAGACGAGTGAGAC
GACAGCTTCTACGCTCCGTGCCTGTGTACCCTTCGGCCGGACATCTGGTGGTCCTAATTGCCTTCTATGTCATCCACCTT
GCGTGCACCTTTGTCCACTTCAACAGGGACGACACTGAGGCCTGGGGCAAGAGACTCGGATGGTGAGTTTTACTACGGTC
CATGTCCTGTCCTCATTTTCGCCCTTCTTCTGCCTGCATCTACCCCTCGACCGCCTTCACGCTCTTCCCACATTTCCGCA
TCGTCCTTCACTTTTCTCCCGCTAACATCCCAGGATTTCCACCTGCGACTTTGTCCTGGTCGTCGTCCTCTCCATGCGCA
ACACCCCCATGGGCCTCCTCACCGGCTACACATATGAGCGTCTCCAGGTGCTCCACCGTACAGCCGGCTACACAGCCATC
TTCTACATGATCCTGCACATGATCCTCTACTGCATCAACTATGGCCGCAACGACAAGCTCGACGAGTTGAAGGCTCTCAA
CATGGTCATGGGTATCATTGCCGGCTGCGCCATGTTTGTCATGCTGATCCTCAGTCTCATCCTGCGCCGCCACCAGTACG
AGCTCTTCTACGCCTCCCACGTCTGCCTCTTTCTCCTCGTCACCATCACCCTCGGCCGCCACCGGCCCAAGTGGAAGAAA
GCTGTGCCACAGGCCTGCGTTTTTGCCGCCTGCATGTGGTTCATTGACCGCATCTGTCGCCGGCTCCGTCTCTTCTTCAA
TGCCATCAACAACTCAGCCACCCTGACGGCTGTCTCGGACGACGGTGACGGCAACGCCACCCGCATCGTCCTCAAGAAGC
GTCTGATCGGCGCTCGGCCTGGCCAGCACTGCTTCCTCTGGATCCCACGCATCCGCCCCCTCGAGACCCATCCCTTTACC
ATTGTCGCCAACGGACCCGGTGGCCTTGAGCTCGTCGCCACCGCTCACGGCGGCTTCACCAAGTCGCTCTACAACTATGT
CAGCAAGTCGCCGTCCCAGCCGCGCACCCTCTGGGCCTCCGTCGATGGGCCCTATGGCAGCTTTCCCGATGTGCACAGCT
ATGATCGTATCATCCTCGTGGCCGGTGGAAGTGGCGCTACCTTCACCTTTGGTCTGGCCACTCACCTGGTTGAGAACCTG
AAGACGGAATCGCAGCAGAAGCTCGACTTTATCTGGTCTGTCCGGAAGAATGGTACGTGTTTTCTGCGTTTTTTAGCTTC
GCCTGCCTTTCCAAATCTATCCAAAACTCTTTCTAATACCCACAGATCGACTGGCCTGGTTCGGCTCCCATATCGACACC
CTCACCAACTTCGATGCTCATGTGGAGATGACTGTTCACGTGACCGCCGACACGCCTCAGGGCCTCTCGACCGACAGCGA
GGGTTCGCTGCCGGTCGACTCGGAGAAGATGCACGGAAGCCCGCTTCCATCCAACAGCTCGGCCGACGACGAGAAGGCTG
TCCAGGGCCGTCTATCTGCTCCCGCAACAGCCCTGTCGTGTTTTGGTCTCAAGAACATCCGCTACGAGAAGTTGCGTGTG
GCCGAGACCATTGAGAGCATTGTATCCACTATTGGCAACGGTCAGCGCGTCCTGATCGCCGCCTGCGGACCCACCGGCCT
GATGAAGGACGTCCGGACTGCGGCGGCTGCCTGTATTCGACCAGAAGGGCCCAGCATCGAGCTGCACTATGAGAGCTTTG
CATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62