GenePrediction:GLEAN_4824 Details

Name: GLEAN_4824
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:63594..62342 (- strand)
Length: 1253
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:63594..63303 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_167:63216..62747 (- strand)
Length: 470
Type: CDS
Source: GLEAN
Position: GCSC_167:62659..62342 (- strand)
Length: 318
>GLEAN_4824 class=GenePrediction position=GCSC_167:63594..62342 (- strand)
ATGTCGTGGAATAGCCCCTTGGCACACCTCCCGCCTCTCTCAGAGCACCCATCTGTCTCGCCGTCGCTCTCTCCGGCCAT
ATCTGATGGCTCTCTTGCAATTCTAGGAGCTAGTGTAAGGCTGGATCAATTTGAAGAGCGAAGCTATAGTGCCTCGCGAG
TTATCCGGGCGTTTCTTGACCATCTAGAGGACGATGGCAAGCGGATGTTGGTGGCAGACATAGCAATCTGCGACGACGAC
GACGCACTTGTCAAACTCGCTAACCACCTTATCGACGCGATTCTAAAGCCGTGTACGCTGCGATATTATCAAGTTGTTTT
CCGTGTTTCTTGTCTTTACTATTGTTTTACTAACTAGGTTTTCTCTCAAATATTTCAGTCAAGCTTGCAGGTGGGCAGGC
TCCAACGCCTCTCTCATTGCCTCAAACCCCTGGAGCAGAACACGCCATCGATGTGGCTATGGCGACGATCGAGACGTCGA
CGAGACAAGAGCAACAGCATTTGCGTGACGATTGCCTGCATCGAGATGGCTACCGATGCGTATATTCTGGGAACTTGGAC
ATGAACAGCTGTGAGAAAGGAGACGTTGTCGTGCCTCCAGGTGCACAGACAACCATAACGCAATGCGCCCACATAATTCC
TTTCGCCCTAGGATCGTTTGACGACACAGACGCCGTCCAGACACGCAACAAAGCTATCATCTGGTTCGCAATTCACAGAT
ACTTTCCAGCAATTCGCGACAAGATTGATACTAGAAGCATCAAGCAGCGCGACAACGCTATAATCTTAGACATCTACGTG
CACGGCTTGTTCGGGGGGTACAACATTGGCTTTCTGCCGCAAGGCTTGGTATGTTTTATAAAGTCTACGCTTTATCTTTC
TCTTGTTCGTTTAGTAAAGAACGGACGATACAACAGAAAACGTACTAACCAACAGAATCTTTATCGTATCACCAAGTTTT
TTACATACGCTATGTCCGTTAACTCGAAAAGCGGCTCTCCGCTTGTAGAGTTTACCAGCCACGATCACACTGTACCCATG
CCGGACGCAGACTTTCTCATGACCCATTATATCATTTCCCAAATCCTTCAAGTGAGTGGAATTGGGCGCCAGCTTGACAA
GGCCGTCGAGATGGCTCTGGTCGATTTAGACTGCCATGCTCTGCATCTAAGCGGAAGCACCGACGTGGGTAACATGATAT
CGCGAAGGCTACTAATGACTGTTCGAACAGGCTTTGGAGACAGCAAGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62