GenePrediction:GLEAN_4825 Details

Name: GLEAN_4825
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:59161..55926 (- strand)
Length: 3236
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:59161..58885 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_167:58534..56867 (- strand)
Length: 1668
Type: CDS
Source: GLEAN
Position: GCSC_167:56791..55926 (- strand)
Length: 866
>GLEAN_4825 class=GenePrediction position=GCSC_167:59161..55926 (- strand)
ATGGAGAAGGGCAACGCGGCCGGTGCAGACGACTCTCTCGCGCAGACATACCCAACCCCGACGACGGACGGACAGGACAG
CACCTCGTTCTACAATGCGGACGGCGACCACGTGGCCATGGACCAGATAGACCCCCAGCTTGAAGCAGGCGTGGACATGC
AGTCGGACGCGGTGGATGGATCCGCAGGCGGCGGCGTGGGCGTGGCGGAGGAGTCGTACCCGGAGTCACATCTGCAGGCG
CTCAAGGCAGAGGACGGAGTCCACCAGGCGGGACAGTGTACGAGGAGGAAGCGACGGGCGACGAGGGTGGATACGGCGAC
GCGTCGCTGGACCAGGGACAGCAGGACGAGCACGTCCAGGACCATGACGGCTCGCAGCAACAGCAACAGCAACAACAACA
ACAGCAACAGCAGCAACAGACACCGACTCAGCATCCACAGCAGCAGCAGCAGCAGCAGCAGCAACACCAGCAACATCAGC
AACATCAGGGCAGTGGAGCTGGCCGTTCGACGGTGAGCGTGGAGGAGCTGCAGCTAGCAGCACAGCTGAGCCAGGGCCTG
GCGCCGATGATGCGGCAGCAGGCGGCAGCGGGCGGCCGCCAGAACGGCGAGGTGGAGGAGTACGCAGACGGGGGGACGGA
TGAGTCGGGGGGATACGGCGGCAGTGGCCAGGACACGTCGTCGGCCGCAGCAGCAGCGGCAGCGGCAGCAGCAGCTGCAG
CAGCTGTGTACCACCACGGCGGATACGGAGACGGGGGCCATGGGCTGCCGACATCGCTGCAGATGGCGCAGATGGCGCAG
CAGGCATACTCGACCAGCGTGGACCACATCCCGCCGCGCAAGCGATCAAAGGTGTCGCGGGCGTGTGACGCGTGCCGGCG
CAAGAAGATCAAGTGCGACTCGGTTTCAGAGGCGGAGCAGTGTAGCAACTGCCGGCGGTCGCACGTGTCGTGTCTGTTCA
GCCGGGTGCCGCAGAAGCGAGGTCCCAGCAAAGGCTATATCAAGGAGCTGGCGGACCGGATTAACAGCATCGAGGGCAAG
CTCGGCGGTGGTGGCGGTGGTGTGTCAGCAGCAGCAGCAGCGGCAGCTACGGCAGACGCGCTCGATCTGTTGGGTGGTGT
TGTTGGGGGAGGAGGCGGAGGTGGTGTCCGTCGCGAGTCGGCGGAGGCGTATTCGACATTTGCGCTCAACGACAATGCCA
AGCGGCCGTATGCAGCCATGGCCGGTGAGGCAGCACAGGGCAGCCAGACGGGTCCAACAGGAAACAGTAGCAGCAGCAGC
AACCACACGAACGGCGGCAACAGTGTCAACGGCAATGCCAACAGTGGCAGCCGTCATGCAGCCTGGGCCACGCCATCGGG
ACGGTCGATGCAGCAACACGGCTACCAGACGGCGATGACGGCGATGACAGCAGCCGCAGCAGCAGCAGCAGCAGCACGCG
GCTCGACTTATTCGGCGGCGAGTCTGGCACCACAGCCGCACATCGGAGGGTCGGTACTAGAGGCAGCGGGCGAGGATGTT
GGCGTACTGTCGTCATCGTCGGCAACAACACGGCCACCGCTGACCGACATGGAACGTCTGCTACCGCTGACAGGCCAAAT
GGACACGTCTCCCCAACAGCAACAGCAGCAGCAACAGGCACATCAGACACAACAGCAGACGCAGCTAGCGAGCCTCGAGC
TGGACGAGGAGATATACAACAGCTACTTAGTAGTGGTGCACCCGACACTACCGTTTTTGGCGGGCTCATGGGGCCGGGCG
ATGGAGCTGCTGGTGCAGTGTACGCCGTTGTTGCAGGGGGCCTTTGTGGCGGCACTGCAGGCAGTGGCGGCGGTGTACGA
CGGCGGTGCCGGCAGCACGGACGGCAGCCGGACGACCTGCAGCCTACTGGGGCAATGGGAGGCCGATGGAGGCGGCGGTG
GATCGCGGGCGCAGGGCCTCGTCCATCTGCAGACGCTGCTGCTGTTGGCTGTTGAGGCCGACAGCCACGGCCCGGCGTCG
CTGCAAGGCCGCCACGGCGTGCTGTCCAAGACGGCACTGCTGGCACGGGCTGTGGCGGCGGCCTATGGTTTGGGGCTGCC
ACAGGCGCAGCTTTCGAGCGAGGGAACGACAGCAGAAGCAGATGGGAACGCGGATTCGGATGGCCGACTTGTGCTGCGTG
CGTGGTGGGCGCTCGTGACGTTGGACCGATGGAACGCCGTGGCCACGGCGCGACCTCTGCTGGTGCCACAGGACAGCGTC
GTCCTCTCGCCGGGACTGCGCGGTCTGGTGGGCGAAGGAGCTTTCCAGCTGATGAGTGAGTACATGGTTTCTCCTTTTCA
TTCTCAATTTCGGCATTGTATTGGCAGGGTCACGTGATCTGACTAAGCAGAACTCTCGTACCTATTTGGATCGAGCATCG
CGCCTCTTGTGCTAGGCCCAGCGACAGCACAGGCGATGCCGCCAGGCAGCGGCGCGGCTTTGGGTGGGCGCATCGAAGCA
GCGTTGGAGATGTGGCGTGTGGACCTGCCGGCGACAGCGACGGACGAGAGCGAGCCGGTGGTGCACCTGGCGTACTGGCA
CTACCGGCTGCTGGCGTACCTGGCGATGCCGTCTGCCCTGGCGACAGATGTGGTCTGGGCGGCGAGCCAGGGTGTTGCGC
TTCTGGTGTCCGTGTCAGCGCTGTCGTTGTCATCGCGACAAGGCGGCGCGGCGGCCGTGACGGCGCGTCTGAGTCCATTG
TACCCGTATTTTCTGGCTTTGCCGGCGGTGGTGTTGGCGGCGATGCTACAGCAAACCAGCAGCAGCGGGGACGCCCGTGA
GACAGCAATGGCAGCAGCGAGCGCGCTGCTGGGTGTGCTGGATGCCGAGGAGGGCAGCACGGGTGGTGGTGGTGCTGTGG
ACGGCGACGGCGACGGCGAGACGGCGATTCGCGCTCAGGCTCAGCCGTTTCCATCGACAGCAGCCGCATGGACATCGCCT
TTGCGAGAGACTCTCAACGAAGCGCTGCAGCAGCGGTCCAGTGGTGCGAGCATGGCCATGGCCACAACAGCGCCGACCGA
CGTCGAAACGGCCACCAACCAGAGCCTTCAGCACCTGGCCGATCTTGCAACGGCCACAGTGGCCAGAGAAGACGACGCGG
CCACGGCAGCGGTCGTGGCCAAACTGCGCAGCTCCGACAACTATGAGGATCTTGGTTTTGACCCGCGACCGCTTCTACGG
GCTGGCTATCTGACTGCCGTCAAGGGGGGGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62