GenePrediction:GLEAN_4827 Details

Name: GLEAN_4827
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:44390..43426 (- strand)
Length: 965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:44390..44009 (- strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_167:43934..43426 (- strand)
Length: 509
>GLEAN_4827 class=GenePrediction position=GCSC_167:44390..43426 (- strand)
ATGGCAAGCAGGATCTGCCGGAGCCGGGCACTGGCCTCGGCTGTTCGGGCGACGCGGCCGGGCCCACCGGCAGTGCAGAA
GCAGGCCGGCGGCGCAGTCCGGTGTCTGTCGAACAGCAGCTCGATGCAGAACTATGTCGTCAAGCTGCCCAAGGATGCGA
CCAACATGCGGCAAGCACCGCGCGAGCCCATTGGCACGCTGGAGGCGCCGGTGGTCAACCCTGCGGACAAGTTCGATCTG
ATGGCCGACAACATGCACCGGTACGGGGCGTGGCTGATGAGCGTGCTGCCCAAGTACGTGCAGCAGTTCTCGGTGTGGAA
GGATGAGTTGACCATCTACATCCCGCCGTCGGGCGTCATCCCGGTCTTTACTTTTTTGAAGTGTAAGTGGTGCATGAGGT
TTGCAGCCCGGGAAGACGAATAGACGGGCAGTAGAGCCAGGTTGCTGACGTTCCAGACAACACGTCGGCCGAGTTCACGC
AGATCAGCGACATCACGGCCGTGGACTTCCCGACGCGCGACCAGCGGTTCGAGATTGTGTACAACCTGCTGAGCGTGCGG
CACAACTCGCGGATCCGGGTCAAGACGTATGCAGATGAGGCTTCGCCGGTGCCCAGCGTGACCAGCCTGTACGACGGTGC
GAACTGGTACGAGCGTGAGGTGTACGACATGTTCGGCGTCTTCTTCGTGGACCACCCGGACCTGCGGCGGATCATGACGG
ACTACGGATTTGAGGGCCACCCGCTACGCAAGGACTTCCCGGTGACAGGCTACACGGAGCTTCGCTACGACGAGGAGAAG
AAGCGCATTGTGACGGAGCCACTGGAGCTGACGCAAGCGTTCCGCAACTTTGAGGGCGGCTCGAGCTCCTGGGAGCAGGT
GGGCGCCGGCCTGGACAAGACGCCGGAGACGTTCAAGCTGCCGACACCGAAGCCAGAGGAGAAGAAGGAGGAGCCAAAGA
AGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62